Incidental Mutation 'R8427:Bcl2l2'
ID 653549
Institutional Source Beutler Lab
Gene Symbol Bcl2l2
Ensembl Gene ENSMUSG00000089682
Gene Name BCL2-like 2
Synonyms Gtrosa41, bclw, Bcl-w, Gtrgal2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.598) question?
Stock # R8427 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 54883377-54888234 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 54885403 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 151 (Y151C)
Ref Sequence ENSEMBL: ENSMUSP00000022806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022806] [ENSMUST00000133397] [ENSMUST00000134077] [ENSMUST00000172844] [ENSMUST00000227108]
AlphaFold P70345
Predicted Effect probably damaging
Transcript: ENSMUST00000022806
AA Change: Y151C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022806
Gene: ENSMUSG00000089682
AA Change: Y151C

DomainStartEndE-ValueType
BH4 6 32 1.28e-11 SMART
BCL 46 144 1.22e-45 SMART
low complexity region 172 188 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133397
SMART Domains Protein: ENSMUSP00000116385
Gene: ENSMUSG00000089682

DomainStartEndE-ValueType
BH4 6 32 1.28e-11 SMART
BCL 46 144 1.22e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134077
SMART Domains Protein: ENSMUSP00000117229
Gene: ENSMUSG00000092232

DomainStartEndE-ValueType
BH4 6 32 1.28e-11 SMART
BCL 46 144 1.22e-45 SMART
low complexity region 155 169 N/A INTRINSIC
RRM 200 272 4.19e-17 SMART
low complexity region 314 326 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172844
AA Change: Y37C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133286
Gene: ENSMUSG00000089682
AA Change: Y37C

DomainStartEndE-ValueType
Pfam:Bcl-2 1 30 3.9e-7 PFAM
Blast:BCL 31 53 1e-7 BLAST
transmembrane domain 55 77 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227108
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the BCL-2 protein family. The proteins of this family form hetero- or homodimers and act as anti- and pro-apoptotic regulators. Expression of this gene in cells has been shown to contribute to reduced cell apoptosis under cytotoxic conditions. Studies of the related gene in mice indicated a role in the survival of NGF- and BDNF-dependent neurons. Mutation and knockout studies of the mouse gene demonstrated an essential role in adult spermatogenesis. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream PABPN1 (poly(A) binding protein, nuclear 1) gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous null mutants are male sterile with progressive loss of germ cells, Sertoli cells and Leydig cells beginning at puberty. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik G T 12: 72,903,286 S271R possibly damaging Het
Adrb2 A G 18: 62,179,274 V160A possibly damaging Het
Atp13a5 T C 16: 29,349,002 D113G possibly damaging Het
B4galt7 T A 13: 55,609,325 V312D possibly damaging Het
Bccip A G 7: 133,709,491 D45G probably benign Het
Ccdc146 T C 5: 21,399,792 E16G unknown Het
Cdr2l C A 11: 115,394,039 D400E probably damaging Het
Celsr2 A C 3: 108,392,633 *2920E probably null Het
Cib1 A G 7: 80,228,001 F183L probably damaging Het
Cnot1 A G 8: 95,734,324 Y1716H probably benign Het
Copb1 A G 7: 114,226,754 V665A probably benign Het
Crmp1 C T 5: 37,291,195 T683I probably damaging Het
Cubn G C 2: 13,428,756 F1114L probably benign Het
Dab2 A T 15: 6,429,359 R251* probably null Het
Ddx28 A G 8: 106,010,280 V382A probably benign Het
Eml1 C A 12: 108,530,321 T612K probably damaging Het
Hoxb3 CGGCGGTGGCGG CGGCGGTGGCGGTGGCGG 11: 96,345,589 probably benign Het
Hoxb3 TGGCGG TGGCGGAGGCGG 11: 96,345,595 probably benign Het
Iapp T A 6: 142,298,886 I13N probably damaging Het
Ifit1bl1 A T 19: 34,599,266 probably null Het
Itgb4 T A 11: 115,991,718 probably null Het
Kcnh3 T C 15: 99,227,053 V128A probably benign Het
Kmt2a A G 9: 44,845,423 F1176L probably damaging Het
Lifr A G 15: 7,190,981 T1031A probably benign Het
Lrp2 T C 2: 69,451,297 D3910G probably damaging Het
Man1a2 A T 3: 100,684,685 S60T probably benign Het
Mdh1 C T 11: 21,564,138 R93K probably benign Het
Mical1 G T 10: 41,478,595 K142N probably damaging Het
Nf2 T A 11: 4,791,118 E365D probably benign Het
Nfrkb A G 9: 31,419,027 M1192V probably benign Het
Npas4 A C 19: 4,986,080 D685E probably benign Het
Olfr1291-ps1 A G 2: 111,499,965 T238A probably damaging Het
Olfr358 G T 2: 37,004,782 Y277* probably null Het
Olfr747 T A 14: 50,681,149 I162F probably damaging Het
Ovch2 G A 7: 107,794,000 T222I probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pld1 A T 3: 28,088,646 I668F probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ppa1 A G 10: 61,660,925 D64G possibly damaging Het
Rnf133 T C 6: 23,649,406 I175V probably benign Het
Rpp30 A G 19: 36,094,412 I127V probably benign Het
Scube2 T A 7: 109,800,590 H913L probably damaging Het
Sema6d T A 2: 124,665,277 S1045T probably benign Het
Skida1 A T 2: 18,046,591 N496K unknown Het
Slc29a2 A T 19: 5,030,420 I397F probably benign Het
Slc38a2 G T 15: 96,692,413 R316S probably damaging Het
Slc40a1 A C 1: 45,912,338 Y220D probably damaging Het
Strc T G 2: 121,377,531 H453P probably damaging Het
Tmprss3 T A 17: 31,188,384 I312F probably damaging Het
Tnn G A 1: 160,130,686 T529I probably damaging Het
Tnr A T 1: 159,886,231 D743V possibly damaging Het
Trim42 A T 9: 97,363,121 F542Y probably benign Het
Trpm2 A T 10: 77,911,402 Y1421N possibly damaging Het
Ttn T C 2: 76,746,557 E24664G probably damaging Het
Ube2q2 T C 9: 55,184,966 probably null Het
Unc79 A T 12: 103,079,038 R824S probably benign Het
V1ra8 A G 6: 90,203,577 D254G probably damaging Het
Vmn1r173 A T 7: 23,702,534 I65F probably damaging Het
Vmn2r16 T A 5: 109,340,272 M337K probably benign Het
Wfs1 C A 5: 36,968,087 G487C probably damaging Het
Xdh T C 17: 73,935,931 Y127C probably damaging Het
Zfp229 T C 17: 21,746,834 S682P probably damaging Het
Zscan4-ps1 A T 7: 11,068,520 D117E possibly damaging Het
Other mutations in Bcl2l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03126:Bcl2l2 APN 14 54884767 missense probably damaging 1.00
R2656:Bcl2l2 UTSW 14 54885432 missense probably benign 0.02
R4042:Bcl2l2 UTSW 14 54884634 missense possibly damaging 0.82
R5278:Bcl2l2 UTSW 14 54884794 missense probably damaging 0.98
R6129:Bcl2l2 UTSW 14 54884745 missense possibly damaging 0.86
R6234:Bcl2l2 UTSW 14 54884788 missense probably benign 0.00
R7205:Bcl2l2 UTSW 14 54884601 missense probably benign
R7699:Bcl2l2 UTSW 14 54884379 start gained probably benign
R7747:Bcl2l2 UTSW 14 54884379 start gained probably benign
R7748:Bcl2l2 UTSW 14 54884379 start gained probably benign
R7779:Bcl2l2 UTSW 14 54884379 start gained probably benign
R7845:Bcl2l2 UTSW 14 54884851 missense unknown
R7855:Bcl2l2 UTSW 14 54884379 start gained probably benign
R8017:Bcl2l2 UTSW 14 54884383 start codon destroyed probably null 0.86
Predicted Primers PCR Primer
(F):5'- TCACGTAGACAGTGCAGAGG -3'
(R):5'- GGGCATTCGCTATTGTTCCAG -3'

Sequencing Primer
(F):5'- CCAGGAACGGGGTTCGGAG -3'
(R):5'- AGCTCTCCTGGCCCCTAG -3'
Posted On 2020-10-20