Incidental Mutation 'R8428:Kif26b'
ID653568
Institutional Source Beutler Lab
Gene Symbol Kif26b
Ensembl Gene ENSMUSG00000026494
Gene Namekinesin family member 26B
SynonymsD230039L06Rik, N-11 kinesin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8428 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location178529125-178939200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 178917358 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1673 (V1673A)
Ref Sequence ENSEMBL: ENSMUSP00000124462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160789] [ENSMUST00000161017]
Predicted Effect probably benign
Transcript: ENSMUST00000160789
AA Change: V1226A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000124608
Gene: ENSMUSG00000026494
AA Change: V1226A

DomainStartEndE-ValueType
KISc 1 362 2.48e-42 SMART
low complexity region 363 375 N/A INTRINSIC
low complexity region 402 416 N/A INTRINSIC
low complexity region 460 466 N/A INTRINSIC
low complexity region 560 600 N/A INTRINSIC
low complexity region 652 662 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 1038 1048 N/A INTRINSIC
low complexity region 1294 1322 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161017
AA Change: V1673A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000124462
Gene: ENSMUSG00000026494
AA Change: V1673A

DomainStartEndE-ValueType
low complexity region 58 123 N/A INTRINSIC
low complexity region 144 155 N/A INTRINSIC
low complexity region 220 228 N/A INTRINSIC
Blast:KISc 365 446 4e-8 BLAST
KISc 448 809 2.48e-42 SMART
low complexity region 810 822 N/A INTRINSIC
low complexity region 849 863 N/A INTRINSIC
low complexity region 907 913 N/A INTRINSIC
low complexity region 1007 1047 N/A INTRINSIC
low complexity region 1099 1109 N/A INTRINSIC
low complexity region 1269 1288 N/A INTRINSIC
low complexity region 1485 1495 N/A INTRINSIC
low complexity region 1741 1769 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality with impaired kidney development due to loss of cortical nephrogenic zone mesenchyme and failure of ureteric buds to invade and branch into the mesenchyme. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 A G 10: 127,087,306 I670V unknown Het
Bcan G T 3: 87,997,098 T117K probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cbx8 C A 11: 119,038,928 V280F probably damaging Het
Ccdc117 A T 11: 5,534,350 S163R possibly damaging Het
Ccdc17 A T 4: 116,599,626 I509F probably damaging Het
Cdon T C 9: 35,491,867 V1091A probably benign Het
Cntnap5b C T 1: 100,383,585 T972I probably damaging Het
Dlg2 T C 7: 91,091,032 L9P possibly damaging Het
Dnah6 T A 6: 73,074,651 R3053S probably benign Het
Dnah7a T A 1: 53,472,953 N2983I probably damaging Het
Dnah7c T C 1: 46,672,376 Y2588H probably damaging Het
Dpysl5 A G 5: 30,745,467 D81G probably damaging Het
Dscaml1 A G 9: 45,742,586 D1387G probably benign Het
Exd1 G T 2: 119,538,867 T89K possibly damaging Het
Ezh2 T A 6: 47,545,811 R364* probably null Het
Fam161b C T 12: 84,357,595 D104N probably benign Het
Fbxw8 C A 5: 118,077,698 V416L probably benign Het
Flnc A T 6: 29,450,850 D1499V probably benign Het
Fmc1 A T 6: 38,539,180 R54* probably null Het
Fzr1 A G 10: 81,371,108 F61S probably damaging Het
Get4 T G 5: 139,265,638 C160G probably benign Het
Gm14548 G A 7: 3,895,258 T355I probably benign Het
Gm32742 G A 9: 51,144,375 R1330* probably null Het
Gnat3 G A 5: 18,015,314 A225T possibly damaging Het
Gucy2c A G 6: 136,727,894 Y541H probably damaging Het
Hand2 A G 8: 57,322,426 T174A probably benign Het
Helb T C 10: 120,091,617 T863A probably damaging Het
Hoxa7 A T 6: 52,218,013 V2D unknown Het
Ifi44 G A 3: 151,739,341 R325* probably null Het
Igfn1 C T 1: 135,967,782 G1682E probably damaging Het
Itch A G 2: 155,168,707 N32D probably benign Het
Map1a A T 2: 121,304,937 D2078V probably benign Het
Mgat4b G T 11: 50,230,685 V35L probably benign Het
Micu3 G A 8: 40,308,164 M38I probably benign Het
Myo15 A T 11: 60,496,415 H706L probably damaging Het
Ndc1 A G 4: 107,368,820 T42A probably benign Het
Nfat5 T A 8: 107,368,520 M1131K probably damaging Het
Nop14 G A 5: 34,641,440 S648L probably damaging Het
Olfr639 G T 7: 104,012,425 Y92* probably null Het
Otogl A G 10: 107,798,736 V1413A probably damaging Het
Palb2 T A 7: 122,112,001 M967L possibly damaging Het
Ppa2 A G 3: 133,348,143 K198R probably damaging Het
Prokr1 T C 6: 87,588,774 T30A probably benign Het
Prss50 C T 9: 110,858,060 R24C unknown Het
Rbm17 T C 2: 11,600,630 T38A possibly damaging Het
Rps6ka5 G A 12: 100,575,241 Q420* probably null Het
Senp6 G T 9: 80,118,512 R448L probably damaging Het
Senp7 T C 16: 56,179,028 I838T probably damaging Het
Sf3b2 C T 19: 5,287,214 S329N possibly damaging Het
Slc13a4 A T 6: 35,268,879 D610E probably benign Het
Slc24a2 A G 4: 87,227,100 L239P probably damaging Het
Slc39a5 T A 10: 128,397,015 H389L probably damaging Het
Syt4 A G 18: 31,444,019 L94P probably damaging Het
Tgm5 A G 2: 121,048,875 V560A probably benign Het
Thoc5 A G 11: 4,926,115 T623A probably damaging Het
Tm7sf2 C T 19: 6,063,044 V376I probably benign Het
Tmem268 T A 4: 63,577,904 V194E probably damaging Het
Tpr C A 1: 150,414,813 R798S probably damaging Het
Trpv5 G T 6: 41,653,248 T685K possibly damaging Het
Ttn A T 2: 76,754,430 N22141K probably damaging Het
Txnrd2 T C 16: 18,456,298 I353T unknown Het
Upk1a A G 7: 30,603,618 Y252H probably damaging Het
Vmn2r118 A G 17: 55,608,642 I436T probably benign Het
Vmn2r76 T A 7: 86,225,271 I833F possibly damaging Het
Zfp277 T C 12: 40,329,578 H319R probably damaging Het
Other mutations in Kif26b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Kif26b APN 1 178915648 missense probably damaging 1.00
IGL00425:Kif26b APN 1 178916301 missense probably damaging 0.96
IGL00952:Kif26b APN 1 178932205 missense probably damaging 1.00
IGL01100:Kif26b APN 1 178917244 missense probably benign
IGL01347:Kif26b APN 1 178870675 missense probably damaging 1.00
IGL01543:Kif26b APN 1 178678961 missense probably benign 0.41
IGL01938:Kif26b APN 1 178916038 missense probably damaging 0.99
IGL02100:Kif26b APN 1 178915947 missense probably damaging 0.99
IGL02262:Kif26b APN 1 178916068 missense probably benign 0.05
IGL02576:Kif26b APN 1 178916347 missense probably benign
IGL02673:Kif26b APN 1 178821605 missense probably damaging 1.00
IGL03078:Kif26b APN 1 178870726 missense probably damaging 1.00
IGL03155:Kif26b APN 1 178874128 missense probably damaging 1.00
IGL03157:Kif26b APN 1 178916365 missense probably damaging 1.00
IGL03162:Kif26b APN 1 178916932 missense probably benign
IGL03220:Kif26b APN 1 178864869 missense probably damaging 1.00
IGL03299:Kif26b APN 1 178821560 missense probably benign 0.09
IGL03368:Kif26b APN 1 178916208 missense probably damaging 1.00
IGL03370:Kif26b APN 1 178915381 missense probably benign 0.39
PIT4449001:Kif26b UTSW 1 178918086 missense probably damaging 1.00
R0142:Kif26b UTSW 1 178915389 missense probably damaging 1.00
R0621:Kif26b UTSW 1 178915653 missense probably benign 0.02
R0987:Kif26b UTSW 1 178821620 missense probably damaging 1.00
R1107:Kif26b UTSW 1 178917673 missense probably benign 0.03
R1367:Kif26b UTSW 1 178916463 missense probably damaging 1.00
R1386:Kif26b UTSW 1 178915644 missense probably benign
R1619:Kif26b UTSW 1 178916478 missense probably benign 0.00
R1664:Kif26b UTSW 1 178932139 missense probably damaging 1.00
R2240:Kif26b UTSW 1 178715923 missense probably benign 0.00
R2264:Kif26b UTSW 1 178928842 critical splice acceptor site probably null
R2443:Kif26b UTSW 1 178915014 missense probably damaging 0.99
R3023:Kif26b UTSW 1 178864868 missense probably damaging 0.99
R3744:Kif26b UTSW 1 178679030 missense probably benign 0.00
R3831:Kif26b UTSW 1 178916616 frame shift probably null
R3832:Kif26b UTSW 1 178916616 frame shift probably null
R3833:Kif26b UTSW 1 178916616 frame shift probably null
R3843:Kif26b UTSW 1 178928177 missense probably damaging 1.00
R4108:Kif26b UTSW 1 178916965 missense possibly damaging 0.88
R4181:Kif26b UTSW 1 178915426 missense probably damaging 0.98
R4551:Kif26b UTSW 1 178884035 missense probably damaging 1.00
R4552:Kif26b UTSW 1 178884035 missense probably damaging 1.00
R4597:Kif26b UTSW 1 178916793 missense probably damaging 1.00
R4599:Kif26b UTSW 1 178530459 missense unknown
R4610:Kif26b UTSW 1 178679355 missense probably damaging 1.00
R4746:Kif26b UTSW 1 178873981 nonsense probably null
R4873:Kif26b UTSW 1 178915327 missense probably benign 0.38
R4875:Kif26b UTSW 1 178915327 missense probably benign 0.38
R5015:Kif26b UTSW 1 178928330 missense probably damaging 0.99
R5060:Kif26b UTSW 1 178530630 missense unknown
R5301:Kif26b UTSW 1 178530668 missense unknown
R5368:Kif26b UTSW 1 178915884 missense probably damaging 1.00
R5387:Kif26b UTSW 1 178914876 missense probably benign 0.01
R5589:Kif26b UTSW 1 178916299 missense probably benign 0.05
R6150:Kif26b UTSW 1 178915546 missense probably damaging 1.00
R6259:Kif26b UTSW 1 178917405 missense probably damaging 0.97
R6355:Kif26b UTSW 1 178916178 missense probably damaging 1.00
R6408:Kif26b UTSW 1 178917568 missense probably damaging 1.00
R6488:Kif26b UTSW 1 178529573 missense unknown
R6546:Kif26b UTSW 1 178928306 missense probably damaging 1.00
R6702:Kif26b UTSW 1 178917287 missense possibly damaging 0.90
R6886:Kif26b UTSW 1 178874138 missense probably damaging 1.00
R6953:Kif26b UTSW 1 178874072 missense possibly damaging 0.89
R7262:Kif26b UTSW 1 178917654 missense possibly damaging 0.84
R7291:Kif26b UTSW 1 178679046 missense possibly damaging 0.86
R7346:Kif26b UTSW 1 178530741 missense probably damaging 1.00
R7383:Kif26b UTSW 1 178530710 missense probably damaging 1.00
R7448:Kif26b UTSW 1 178914774 missense probably damaging 1.00
R7506:Kif26b UTSW 1 178529499 start gained probably benign
R7562:Kif26b UTSW 1 178914976 missense probably damaging 1.00
R7583:Kif26b UTSW 1 178530445 nonsense probably null
R7585:Kif26b UTSW 1 178916496 missense probably benign 0.01
R7644:Kif26b UTSW 1 178679274 missense probably benign 0.04
R7759:Kif26b UTSW 1 178678944 missense probably damaging 1.00
R7775:Kif26b UTSW 1 178864876 missense probably benign 0.15
R7954:Kif26b UTSW 1 178869379 missense probably damaging 0.99
R7960:Kif26b UTSW 1 178678919 missense probably damaging 1.00
R8012:Kif26b UTSW 1 178916250 missense probably benign 0.20
R8152:Kif26b UTSW 1 178679229 missense possibly damaging 0.46
R8320:Kif26b UTSW 1 178884076 critical splice donor site probably null
R8360:Kif26b UTSW 1 178916373 missense probably benign 0.18
R8670:Kif26b UTSW 1 178913784 missense probably damaging 1.00
R8737:Kif26b UTSW 1 178864865 missense probably damaging 0.99
R8788:Kif26b UTSW 1 178529525 start gained probably benign
R8854:Kif26b UTSW 1 178916383 missense possibly damaging 0.93
R8870:Kif26b UTSW 1 178865029 missense probably damaging 1.00
X0021:Kif26b UTSW 1 178928159 missense probably damaging 1.00
X0024:Kif26b UTSW 1 178679082 missense probably benign 0.14
X0025:Kif26b UTSW 1 178915266 nonsense probably null
X0025:Kif26b UTSW 1 178915383 missense possibly damaging 0.70
Z1177:Kif26b UTSW 1 178821548 missense probably benign 0.11
Z1177:Kif26b UTSW 1 178821550 nonsense probably null
Z1177:Kif26b UTSW 1 178915405 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTAGCTTGGACCAGAAGAAC -3'
(R):5'- TCTTAGACTGGCTGGCCTTG -3'

Sequencing Primer
(F):5'- CAGCCCTCAACACGGTG -3'
(R):5'- CTGGCTGGCCTTGGGAGAG -3'
Posted On2020-10-20