Incidental Mutation 'R8428:Rbm17'
ID653569
Institutional Source Beutler Lab
Gene Symbol Rbm17
Ensembl Gene ENSMUSG00000037197
Gene NameRNA binding motif protein 17
Synonyms2700027J02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R8428 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location11585437-11604153 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11600630 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 38 (T38A)
Ref Sequence ENSEMBL: ENSMUSP00000041831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040314] [ENSMUST00000156469]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040314
AA Change: T38A

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000041831
Gene: ENSMUSG00000037197
AA Change: T38A

DomainStartEndE-ValueType
coiled coil region 106 144 N/A INTRINSIC
low complexity region 148 166 N/A INTRINSIC
G_patch 233 279 4.97e-13 SMART
RRM 310 389 4.69e-29 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000156469
AA Change: T38A

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA binding protein. The encoded protein is part of the spliceosome complex and functions in the second catalytic step of mRNA splicing. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 9 and 15. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 A G 10: 127,087,306 I670V unknown Het
Bcan G T 3: 87,997,098 T117K probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cbx8 C A 11: 119,038,928 V280F probably damaging Het
Ccdc117 A T 11: 5,534,350 S163R possibly damaging Het
Ccdc17 A T 4: 116,599,626 I509F probably damaging Het
Cdon T C 9: 35,491,867 V1091A probably benign Het
Cntnap5b C T 1: 100,383,585 T972I probably damaging Het
Dlg2 T C 7: 91,091,032 L9P possibly damaging Het
Dnah6 T A 6: 73,074,651 R3053S probably benign Het
Dnah7a T A 1: 53,472,953 N2983I probably damaging Het
Dnah7c T C 1: 46,672,376 Y2588H probably damaging Het
Dpysl5 A G 5: 30,745,467 D81G probably damaging Het
Dscaml1 A G 9: 45,742,586 D1387G probably benign Het
Exd1 G T 2: 119,538,867 T89K possibly damaging Het
Ezh2 T A 6: 47,545,811 R364* probably null Het
Fam161b C T 12: 84,357,595 D104N probably benign Het
Fbxw8 C A 5: 118,077,698 V416L probably benign Het
Flnc A T 6: 29,450,850 D1499V probably benign Het
Fmc1 A T 6: 38,539,180 R54* probably null Het
Fzr1 A G 10: 81,371,108 F61S probably damaging Het
Get4 T G 5: 139,265,638 C160G probably benign Het
Gm14548 G A 7: 3,895,258 T355I probably benign Het
Gm32742 G A 9: 51,144,375 R1330* probably null Het
Gnat3 G A 5: 18,015,314 A225T possibly damaging Het
Gucy2c A G 6: 136,727,894 Y541H probably damaging Het
Hand2 A G 8: 57,322,426 T174A probably benign Het
Helb T C 10: 120,091,617 T863A probably damaging Het
Hoxa7 A T 6: 52,218,013 V2D unknown Het
Ifi44 G A 3: 151,739,341 R325* probably null Het
Igfn1 C T 1: 135,967,782 G1682E probably damaging Het
Itch A G 2: 155,168,707 N32D probably benign Het
Kif26b T C 1: 178,917,358 V1673A probably benign Het
Map1a A T 2: 121,304,937 D2078V probably benign Het
Mgat4b G T 11: 50,230,685 V35L probably benign Het
Micu3 G A 8: 40,308,164 M38I probably benign Het
Myo15 A T 11: 60,496,415 H706L probably damaging Het
Ndc1 A G 4: 107,368,820 T42A probably benign Het
Nfat5 T A 8: 107,368,520 M1131K probably damaging Het
Nop14 G A 5: 34,641,440 S648L probably damaging Het
Olfr639 G T 7: 104,012,425 Y92* probably null Het
Otogl A G 10: 107,798,736 V1413A probably damaging Het
Palb2 T A 7: 122,112,001 M967L possibly damaging Het
Ppa2 A G 3: 133,348,143 K198R probably damaging Het
Prokr1 T C 6: 87,588,774 T30A probably benign Het
Prss50 C T 9: 110,858,060 R24C unknown Het
Rps6ka5 G A 12: 100,575,241 Q420* probably null Het
Senp6 G T 9: 80,118,512 R448L probably damaging Het
Senp7 T C 16: 56,179,028 I838T probably damaging Het
Sf3b2 C T 19: 5,287,214 S329N possibly damaging Het
Slc13a4 A T 6: 35,268,879 D610E probably benign Het
Slc24a2 A G 4: 87,227,100 L239P probably damaging Het
Slc39a5 T A 10: 128,397,015 H389L probably damaging Het
Syt4 A G 18: 31,444,019 L94P probably damaging Het
Tgm5 A G 2: 121,048,875 V560A probably benign Het
Thoc5 A G 11: 4,926,115 T623A probably damaging Het
Tm7sf2 C T 19: 6,063,044 V376I probably benign Het
Tmem268 T A 4: 63,577,904 V194E probably damaging Het
Tpr C A 1: 150,414,813 R798S probably damaging Het
Trpv5 G T 6: 41,653,248 T685K possibly damaging Het
Ttn A T 2: 76,754,430 N22141K probably damaging Het
Txnrd2 T C 16: 18,456,298 I353T unknown Het
Upk1a A G 7: 30,603,618 Y252H probably damaging Het
Vmn2r118 A G 17: 55,608,642 I436T probably benign Het
Vmn2r76 T A 7: 86,225,271 I833F possibly damaging Het
Zfp277 T C 12: 40,329,578 H319R probably damaging Het
Other mutations in Rbm17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02021:Rbm17 APN 2 11595438 unclassified probably benign
R0178:Rbm17 UTSW 2 11587779 missense probably benign 0.04
R0180:Rbm17 UTSW 2 11587779 missense probably benign 0.04
R1457:Rbm17 UTSW 2 11593461 missense probably benign 0.11
R1606:Rbm17 UTSW 2 11595397 missense probably benign
R1672:Rbm17 UTSW 2 11585719 missense possibly damaging 0.95
R1941:Rbm17 UTSW 2 11589074 missense possibly damaging 0.95
R2327:Rbm17 UTSW 2 11598131 missense probably damaging 1.00
R2859:Rbm17 UTSW 2 11590704 missense possibly damaging 0.84
R3813:Rbm17 UTSW 2 11595435 unclassified probably benign
R5887:Rbm17 UTSW 2 11585674 missense probably damaging 1.00
R6866:Rbm17 UTSW 2 11598090 missense probably benign 0.06
R6985:Rbm17 UTSW 2 11590693 missense probably benign
Z1176:Rbm17 UTSW 2 11596768 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTAAAGCCAGTCTCATGGC -3'
(R):5'- ATGGTGCAGCTGTTTTAACAC -3'

Sequencing Primer
(F):5'- TTTCCAAGAGCCAGGAGA -3'
(R):5'- GTGCAGCTGTTTTAACACAGAGAC -3'
Posted On2020-10-20