Incidental Mutation 'R0288:Vmn2r28'
ID65357
Institutional Source Beutler Lab
Gene Symbol Vmn2r28
Ensembl Gene ENSMUSG00000066820
Gene Namevomeronasal 2, receptor 28
SynonymsEG665255
MMRRC Submission 038507-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R0288 (G1)
Quality Score149
Status Not validated
Chromosome7
Chromosomal Location5479531-5493967 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5488021 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 409 (L409P)
Ref Sequence ENSEMBL: ENSMUSP00000083477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086297]
Predicted Effect probably damaging
Transcript: ENSMUST00000086297
AA Change: L409P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083477
Gene: ENSMUSG00000066820
AA Change: L409P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 470 1.7e-26 PFAM
Pfam:NCD3G 512 565 9.8e-21 PFAM
Pfam:7tm_3 598 833 2.8e-56 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.7%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 A G 8: 95,039,940 E413G possibly damaging Het
Amigo2 G T 15: 97,245,679 N287K probably damaging Het
Ankle2 T A 5: 110,236,390 I260K probably damaging Het
Apob C T 12: 7,990,779 R635* probably null Het
Camkv A G 9: 107,946,356 Y153C probably damaging Het
Capn9 A G 8: 124,600,491 probably benign Het
Ces2c A G 8: 104,849,744 I130V probably benign Het
Cfap44 T A 16: 44,415,894 probably benign Het
Cfhr3 A G 1: 139,597,687 noncoding transcript Het
Chmp1a G T 8: 123,208,006 D70E probably damaging Het
Coil G A 11: 88,981,868 G352R probably damaging Het
Colq T C 14: 31,543,992 E188G possibly damaging Het
Cyfip2 A G 11: 46,253,972 F685S possibly damaging Het
Cyp4f39 A G 17: 32,492,436 N519S probably benign Het
Dennd1c A T 17: 57,076,870 probably null Het
Dnah9 A T 11: 66,025,134 probably null Het
Dnmbp T C 19: 43,902,459 T290A possibly damaging Het
Dsc2 T C 18: 20,033,120 D818G probably damaging Het
Gnptab G A 10: 88,433,105 V557I probably benign Het
Hdac4 A T 1: 91,971,006 H675Q probably damaging Het
Kcnk3 T C 5: 30,588,420 M35T probably benign Het
Kif1b A T 4: 149,199,338 I1290N probably damaging Het
Klhl14 G A 18: 21,565,563 R398W probably damaging Het
Marveld1 T C 19: 42,147,826 F60L probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Ndst3 A T 3: 123,672,194 V43D probably benign Het
Nhsl1 A G 10: 18,524,046 D306G probably damaging Het
Nlrp2 A G 7: 5,328,545 V284A probably benign Het
Pcdhb15 T C 18: 37,475,398 V561A probably damaging Het
Pdcl2 T C 5: 76,312,497 I177V possibly damaging Het
Pkd1l3 G A 8: 109,646,499 probably null Het
Pla2g6 A C 15: 79,286,906 probably benign Het
Plekhj1 A T 10: 80,796,610 I122N probably damaging Het
Pmel T C 10: 128,714,306 I70T probably benign Het
Psip1 T C 4: 83,464,959 D273G probably damaging Het
Rictor A G 15: 6,786,540 I1098V probably benign Het
Rif1 T C 2: 52,110,013 S1160P probably damaging Het
Rsbn1l T C 5: 20,920,040 I255V probably damaging Het
Slc15a5 A G 6: 138,017,916 probably benign Het
Slc29a1 G A 17: 45,589,804 R111W probably damaging Het
Slc36a1 G A 11: 55,219,087 A74T probably damaging Het
Slc5a7 A T 17: 54,293,018 Y122* probably null Het
Slc6a3 G T 13: 73,560,928 G324W probably damaging Het
Sltm T C 9: 70,579,351 S433P probably damaging Het
Spta1 T C 1: 174,243,179 S2190P probably damaging Het
Sry A T Y: 2,662,818 F281I unknown Het
Stk32a T A 18: 43,304,995 probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tbl3 G A 17: 24,701,807 H612Y probably damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Top2a A G 11: 99,016,423 probably benign Het
Usp9y A T Y: 1,333,606 probably benign Het
Vldlr G A 19: 27,240,651 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps13c T C 9: 67,927,366 V1659A probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zfp280d A T 9: 72,331,339 K646* probably null Het
Zfp36 A G 7: 28,378,241 S81P probably benign Het
Zfp618 A T 4: 63,132,934 T651S possibly damaging Het
Other mutations in Vmn2r28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Vmn2r28 APN 7 5488069 missense probably benign 0.12
IGL01061:Vmn2r28 APN 7 5488184 missense probably damaging 1.00
IGL01160:Vmn2r28 APN 7 5486478 missense probably damaging 0.99
IGL01335:Vmn2r28 APN 7 5481088 missense possibly damaging 0.67
IGL01532:Vmn2r28 APN 7 5486464 missense probably benign 0.16
IGL01791:Vmn2r28 APN 7 5488162 missense probably benign 0.00
IGL01875:Vmn2r28 APN 7 5481303 missense probably benign 0.30
IGL02161:Vmn2r28 APN 7 5488124 missense possibly damaging 0.88
IGL02499:Vmn2r28 APN 7 5490569 missense probably damaging 0.98
IGL02858:Vmn2r28 APN 7 5481004 missense probably damaging 0.99
IGL03061:Vmn2r28 APN 7 5484016 missense probably damaging 0.98
R0361:Vmn2r28 UTSW 7 5493716 missense probably benign 0.00
R0396:Vmn2r28 UTSW 7 5488514 missense probably benign 0.05
R0480:Vmn2r28 UTSW 7 5490457 missense probably benign 0.00
R0485:Vmn2r28 UTSW 7 5488690 missense probably damaging 1.00
R0837:Vmn2r28 UTSW 7 5488027 missense probably damaging 0.99
R1282:Vmn2r28 UTSW 7 5481302 missense probably damaging 0.99
R1296:Vmn2r28 UTSW 7 5481545 missense possibly damaging 0.81
R1829:Vmn2r28 UTSW 7 5493811 missense probably benign
R1853:Vmn2r28 UTSW 7 5481247 nonsense probably null
R1869:Vmn2r28 UTSW 7 5486346 missense probably benign 0.00
R1887:Vmn2r28 UTSW 7 5488289 missense possibly damaging 0.90
R1961:Vmn2r28 UTSW 7 5481071 missense possibly damaging 0.85
R1998:Vmn2r28 UTSW 7 5488314 missense possibly damaging 0.87
R2392:Vmn2r28 UTSW 7 5484131 missense probably damaging 0.98
R2432:Vmn2r28 UTSW 7 5488702 missense probably damaging 0.99
R3055:Vmn2r28 UTSW 7 5481392 missense probably damaging 0.98
R3753:Vmn2r28 UTSW 7 5488027 missense probably damaging 0.99
R3877:Vmn2r28 UTSW 7 5488358 missense probably damaging 1.00
R4307:Vmn2r28 UTSW 7 5490708 missense probably damaging 0.99
R5023:Vmn2r28 UTSW 7 5486464 missense probably benign 0.16
R5057:Vmn2r28 UTSW 7 5486464 missense probably benign 0.16
R5083:Vmn2r28 UTSW 7 5480672 missense possibly damaging 0.77
R5427:Vmn2r28 UTSW 7 5486377 missense probably damaging 0.99
R5472:Vmn2r28 UTSW 7 5487944 critical splice donor site probably null
R5511:Vmn2r28 UTSW 7 5484012 missense possibly damaging 0.61
R5731:Vmn2r28 UTSW 7 5488669 missense probably benign 0.41
R6091:Vmn2r28 UTSW 7 5493791 missense possibly damaging 0.88
R6179:Vmn2r28 UTSW 7 5488004 nonsense probably null
R6276:Vmn2r28 UTSW 7 5490731 missense probably benign 0.01
R6441:Vmn2r28 UTSW 7 5488475 missense probably benign 0.00
R6463:Vmn2r28 UTSW 7 5486436 missense probably benign 0.07
R6528:Vmn2r28 UTSW 7 5490685 missense probably benign 0.12
R6725:Vmn2r28 UTSW 7 5488409 missense probably benign 0.13
R6760:Vmn2r28 UTSW 7 5481230 missense probably damaging 0.97
R6849:Vmn2r28 UTSW 7 5480807 missense probably damaging 1.00
R7110:Vmn2r28 UTSW 7 5490734 missense probably benign 0.06
R7146:Vmn2r28 UTSW 7 5481496 missense probably benign 0.05
R7407:Vmn2r28 UTSW 7 5481309 missense probably damaging 1.00
R7563:Vmn2r28 UTSW 7 5488201 missense probably benign 0.00
R7611:Vmn2r28 UTSW 7 5481256 missense probably benign 0.02
R7808:Vmn2r28 UTSW 7 5493679 missense probably damaging 0.98
R7862:Vmn2r28 UTSW 7 5490614 missense probably benign 0.00
R7945:Vmn2r28 UTSW 7 5490614 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGGACATCTGAGAGACACTAAATGGC -3'
(R):5'- ACTTTACTTCCAATGGAACTGGGTCG -3'

Sequencing Primer
(F):5'- TGGCTATGCAATTGAAGACACC -3'
(R):5'- GTTATACAGAGAATATGGGTCACCAC -3'
Posted On2013-08-08