Incidental Mutation 'R8428:Senp6'
ID653609
Institutional Source Beutler Lab
Gene Symbol Senp6
Ensembl Gene ENSMUSG00000034252
Gene NameSUMO/sentrin specific peptidase 6
SynonymsE130319N12Rik, 2810017C20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8428 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location80066903-80144953 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 80118512 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 448 (R448L)
Ref Sequence ENSEMBL: ENSMUSP00000126777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037484] [ENSMUST00000164859] [ENSMUST00000165607] [ENSMUST00000175999] [ENSMUST00000176360] [ENSMUST00000176640]
Predicted Effect probably damaging
Transcript: ENSMUST00000037484
AA Change: R441L

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047220
Gene: ENSMUSG00000034252
AA Change: R441L

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
ZnF_C2HC 242 260 7.23e0 SMART
Pfam:Peptidase_C48 700 826 3.5e-23 PFAM
Pfam:Peptidase_C48 965 1096 1.1e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164859
AA Change: R275L

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128918
Gene: ENSMUSG00000034252
AA Change: R275L

DomainStartEndE-ValueType
ZnF_C2HC 76 94 7.23e0 SMART
Pfam:Peptidase_C48 534 660 5.2e-23 PFAM
Pfam:Peptidase_C48 799 930 1.6e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165607
AA Change: R448L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126777
Gene: ENSMUSG00000034252
AA Change: R448L

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
ZnF_C2HC 249 267 7.23e0 SMART
Pfam:Peptidase_C48 707 833 3.4e-23 PFAM
Pfam:Peptidase_C48 972 1103 1.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175999
Predicted Effect unknown
Transcript: ENSMUST00000176360
AA Change: R192L
Predicted Effect probably benign
Transcript: ENSMUST00000176640
Predicted Effect probably damaging
Transcript: ENSMUST00000176648
AA Change: R120L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin-like molecules (UBLs), such as SUMO1 (UBL1; MIM 601912), are structurally related to ubiquitin (MIM 191339) and can be ligated to target proteins in a similar manner as ubiquitin. However, covalent attachment of UBLs does not result in degradation of the modified proteins. SUMO1 modification is implicated in the targeting of RANGAP1 (MIM 602362) to the nuclear pore complex, as well as in stabilization of I-kappa-B-alpha (NFKBIA; MIM 164008) from degradation by the 26S proteasome. Like ubiquitin, UBLs are synthesized as precursor proteins, with 1 or more amino acids following the C-terminal glycine-glycine residues of the mature UBL protein. Thus, the tail sequences of the UBL precursors need to be removed by UBL-specific proteases, such as SENP6, prior to their conjugation to target proteins (Kim et al., 2000 [PubMed 10799485]). SENPs also display isopeptidase activity for deconjugation of SUMO-conjugated substrates (Lima and Reverter, 2008 [PubMed 18799455]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 A G 10: 127,087,306 I670V unknown Het
Bcan G T 3: 87,997,098 T117K probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cbx8 C A 11: 119,038,928 V280F probably damaging Het
Ccdc117 A T 11: 5,534,350 S163R possibly damaging Het
Ccdc17 A T 4: 116,599,626 I509F probably damaging Het
Cdon T C 9: 35,491,867 V1091A probably benign Het
Cntnap5b C T 1: 100,383,585 T972I probably damaging Het
Dlg2 T C 7: 91,091,032 L9P possibly damaging Het
Dnah6 T A 6: 73,074,651 R3053S probably benign Het
Dnah7a T A 1: 53,472,953 N2983I probably damaging Het
Dnah7c T C 1: 46,672,376 Y2588H probably damaging Het
Dpysl5 A G 5: 30,745,467 D81G probably damaging Het
Dscaml1 A G 9: 45,742,586 D1387G probably benign Het
Exd1 G T 2: 119,538,867 T89K possibly damaging Het
Ezh2 T A 6: 47,545,811 R364* probably null Het
Fam161b C T 12: 84,357,595 D104N probably benign Het
Fbxw8 C A 5: 118,077,698 V416L probably benign Het
Flnc A T 6: 29,450,850 D1499V probably benign Het
Fmc1 A T 6: 38,539,180 R54* probably null Het
Fzr1 A G 10: 81,371,108 F61S probably damaging Het
Get4 T G 5: 139,265,638 C160G probably benign Het
Gm14548 G A 7: 3,895,258 T355I probably benign Het
Gm32742 G A 9: 51,144,375 R1330* probably null Het
Gnat3 G A 5: 18,015,314 A225T possibly damaging Het
Gucy2c A G 6: 136,727,894 Y541H probably damaging Het
Hand2 A G 8: 57,322,426 T174A probably benign Het
Helb T C 10: 120,091,617 T863A probably damaging Het
Hoxa7 A T 6: 52,218,013 V2D unknown Het
Ifi44 G A 3: 151,739,341 R325* probably null Het
Igfn1 C T 1: 135,967,782 G1682E probably damaging Het
Itch A G 2: 155,168,707 N32D probably benign Het
Kif26b T C 1: 178,917,358 V1673A probably benign Het
Map1a A T 2: 121,304,937 D2078V probably benign Het
Mgat4b G T 11: 50,230,685 V35L probably benign Het
Micu3 G A 8: 40,308,164 M38I probably benign Het
Myo15 A T 11: 60,496,415 H706L probably damaging Het
Ndc1 A G 4: 107,368,820 T42A probably benign Het
Nfat5 T A 8: 107,368,520 M1131K probably damaging Het
Nop14 G A 5: 34,641,440 S648L probably damaging Het
Olfr639 G T 7: 104,012,425 Y92* probably null Het
Otogl A G 10: 107,798,736 V1413A probably damaging Het
Palb2 T A 7: 122,112,001 M967L possibly damaging Het
Ppa2 A G 3: 133,348,143 K198R probably damaging Het
Prokr1 T C 6: 87,588,774 T30A probably benign Het
Prss50 C T 9: 110,858,060 R24C unknown Het
Rbm17 T C 2: 11,600,630 T38A possibly damaging Het
Rps6ka5 G A 12: 100,575,241 Q420* probably null Het
Senp7 T C 16: 56,179,028 I838T probably damaging Het
Sf3b2 C T 19: 5,287,214 S329N possibly damaging Het
Slc13a4 A T 6: 35,268,879 D610E probably benign Het
Slc24a2 A G 4: 87,227,100 L239P probably damaging Het
Slc39a5 T A 10: 128,397,015 H389L probably damaging Het
Syt4 A G 18: 31,444,019 L94P probably damaging Het
Tgm5 A G 2: 121,048,875 V560A probably benign Het
Thoc5 A G 11: 4,926,115 T623A probably damaging Het
Tm7sf2 C T 19: 6,063,044 V376I probably benign Het
Tmem268 T A 4: 63,577,904 V194E probably damaging Het
Tpr C A 1: 150,414,813 R798S probably damaging Het
Trpv5 G T 6: 41,653,248 T685K possibly damaging Het
Ttn A T 2: 76,754,430 N22141K probably damaging Het
Txnrd2 T C 16: 18,456,298 I353T unknown Het
Upk1a A G 7: 30,603,618 Y252H probably damaging Het
Vmn2r118 A G 17: 55,608,642 I436T probably benign Het
Vmn2r76 T A 7: 86,225,271 I833F possibly damaging Het
Zfp277 T C 12: 40,329,578 H319R probably damaging Het
Other mutations in Senp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Senp6 APN 9 80116610 missense probably damaging 1.00
IGL00487:Senp6 APN 9 80113838 missense probably damaging 1.00
IGL01285:Senp6 APN 9 80136718 missense probably benign 0.05
IGL01337:Senp6 APN 9 80136510 missense probably damaging 0.97
IGL01563:Senp6 APN 9 80122008 missense probably benign
IGL01633:Senp6 APN 9 80092394 missense probably damaging 1.00
IGL02115:Senp6 APN 9 80121926 missense probably damaging 1.00
IGL02208:Senp6 APN 9 80113943 missense probably damaging 1.00
IGL02378:Senp6 APN 9 80126392 missense probably damaging 1.00
A4554:Senp6 UTSW 9 80148458 unclassified probably benign
R0031:Senp6 UTSW 9 80126243 missense probably damaging 1.00
R0121:Senp6 UTSW 9 80116670 missense probably benign 0.01
R0276:Senp6 UTSW 9 80136747 missense probably benign
R0294:Senp6 UTSW 9 80113725 splice site probably null
R0308:Senp6 UTSW 9 80132983 critical splice donor site probably null
R0531:Senp6 UTSW 9 80123884 missense probably damaging 0.99
R0743:Senp6 UTSW 9 80093589 missense probably damaging 1.00
R0883:Senp6 UTSW 9 80116559 missense probably damaging 1.00
R1071:Senp6 UTSW 9 80136729 missense probably benign 0.35
R1171:Senp6 UTSW 9 80116725 missense possibly damaging 0.89
R1340:Senp6 UTSW 9 80122023 missense possibly damaging 0.47
R1571:Senp6 UTSW 9 80093571 missense probably damaging 1.00
R1760:Senp6 UTSW 9 80118629 missense probably benign 0.36
R1909:Senp6 UTSW 9 80113774 missense possibly damaging 0.67
R2008:Senp6 UTSW 9 80126398 missense probably damaging 1.00
R2067:Senp6 UTSW 9 80089869 missense probably benign 0.11
R2077:Senp6 UTSW 9 80126155 missense probably benign 0.14
R2141:Senp6 UTSW 9 80123820 missense probably damaging 1.00
R2321:Senp6 UTSW 9 80123740 missense possibly damaging 0.83
R2760:Senp6 UTSW 9 80121978 missense probably null
R2939:Senp6 UTSW 9 80143842 missense probably benign 0.00
R2940:Senp6 UTSW 9 80143842 missense probably benign 0.00
R3081:Senp6 UTSW 9 80143842 missense probably benign 0.00
R3784:Senp6 UTSW 9 80092286 missense probably benign 0.16
R3785:Senp6 UTSW 9 80092286 missense probably benign 0.16
R3800:Senp6 UTSW 9 80087453 missense possibly damaging 0.89
R3857:Senp6 UTSW 9 80092321 missense possibly damaging 0.85
R4790:Senp6 UTSW 9 80089858 missense probably benign 0.20
R5117:Senp6 UTSW 9 80130746 missense probably damaging 1.00
R5418:Senp6 UTSW 9 80121869 missense possibly damaging 0.89
R5477:Senp6 UTSW 9 80143843 missense probably damaging 1.00
R5582:Senp6 UTSW 9 80089876 missense possibly damaging 0.91
R5717:Senp6 UTSW 9 80092312 missense probably damaging 0.99
R5800:Senp6 UTSW 9 80126433 missense probably damaging 1.00
R5802:Senp6 UTSW 9 80118644 unclassified probably benign
R5899:Senp6 UTSW 9 80142070 splice site probably benign
R5918:Senp6 UTSW 9 80114116 critical splice donor site probably null
R5958:Senp6 UTSW 9 80142294 missense probably damaging 1.00
R6360:Senp6 UTSW 9 80113806 missense probably benign
R6477:Senp6 UTSW 9 80093625 nonsense probably null
R6628:Senp6 UTSW 9 80132954 missense probably damaging 1.00
R6703:Senp6 UTSW 9 80121921 missense probably damaging 1.00
R7236:Senp6 UTSW 9 80132965 missense probably damaging 1.00
R7268:Senp6 UTSW 9 80142124 missense probably damaging 1.00
R7290:Senp6 UTSW 9 80136515 missense probably benign 0.25
R7319:Senp6 UTSW 9 80126199 missense probably damaging 1.00
R7422:Senp6 UTSW 9 80113877 missense probably damaging 1.00
R7474:Senp6 UTSW 9 80142328 missense probably damaging 1.00
R7480:Senp6 UTSW 9 80121917 missense probably damaging 1.00
R7491:Senp6 UTSW 9 80123728 nonsense probably null
R8920:Senp6 UTSW 9 80092279 missense probably benign 0.06
Z1176:Senp6 UTSW 9 80142266 missense probably benign 0.02
Z1177:Senp6 UTSW 9 80103693 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AACATAGCCAGTGTGTTTTGTGAG -3'
(R):5'- ACTGATTAACCAAGTCAGAGTCATC -3'

Sequencing Primer
(F):5'- CCAGTGTGTTTTGTGAGTTTTATTTC -3'
(R):5'- CTCGTATACTTCGGCAGT -3'
Posted On2020-10-20