Incidental Mutation 'R8428:Thoc5'
ID653616
Institutional Source Beutler Lab
Gene Symbol Thoc5
Ensembl Gene ENSMUSG00000034274
Gene NameTHO complex 5
Synonyms1700060C24Rik, PK1.3, A430085L24Rik, Fmip
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8428 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location4895320-4928867 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4926115 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 623 (T623A)
Ref Sequence ENSEMBL: ENSMUSP00000045580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038237] [ENSMUST00000101615]
Predicted Effect probably damaging
Transcript: ENSMUST00000038237
AA Change: T623A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045580
Gene: ENSMUSG00000034274
AA Change: T623A

DomainStartEndE-ValueType
Pfam:FimP 97 452 1.1e-133 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101615
AA Change: T575A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099137
Gene: ENSMUSG00000034274
AA Change: T575A

DomainStartEndE-ValueType
low complexity region 34 41 N/A INTRINSIC
Pfam:FimP 48 405 7.5e-142 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E5.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 A G 10: 127,087,306 I670V unknown Het
Bcan G T 3: 87,997,098 T117K probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cbx8 C A 11: 119,038,928 V280F probably damaging Het
Ccdc117 A T 11: 5,534,350 S163R possibly damaging Het
Ccdc17 A T 4: 116,599,626 I509F probably damaging Het
Cdon T C 9: 35,491,867 V1091A probably benign Het
Cntnap5b C T 1: 100,383,585 T972I probably damaging Het
Dlg2 T C 7: 91,091,032 L9P possibly damaging Het
Dnah6 T A 6: 73,074,651 R3053S probably benign Het
Dnah7a T A 1: 53,472,953 N2983I probably damaging Het
Dnah7c T C 1: 46,672,376 Y2588H probably damaging Het
Dpysl5 A G 5: 30,745,467 D81G probably damaging Het
Dscaml1 A G 9: 45,742,586 D1387G probably benign Het
Exd1 G T 2: 119,538,867 T89K possibly damaging Het
Ezh2 T A 6: 47,545,811 R364* probably null Het
Fam161b C T 12: 84,357,595 D104N probably benign Het
Fbxw8 C A 5: 118,077,698 V416L probably benign Het
Flnc A T 6: 29,450,850 D1499V probably benign Het
Fmc1 A T 6: 38,539,180 R54* probably null Het
Fzr1 A G 10: 81,371,108 F61S probably damaging Het
Get4 T G 5: 139,265,638 C160G probably benign Het
Gm14548 G A 7: 3,895,258 T355I probably benign Het
Gm32742 G A 9: 51,144,375 R1330* probably null Het
Gnat3 G A 5: 18,015,314 A225T possibly damaging Het
Gucy2c A G 6: 136,727,894 Y541H probably damaging Het
Hand2 A G 8: 57,322,426 T174A probably benign Het
Helb T C 10: 120,091,617 T863A probably damaging Het
Hoxa7 A T 6: 52,218,013 V2D unknown Het
Ifi44 G A 3: 151,739,341 R325* probably null Het
Igfn1 C T 1: 135,967,782 G1682E probably damaging Het
Itch A G 2: 155,168,707 N32D probably benign Het
Kif26b T C 1: 178,917,358 V1673A probably benign Het
Map1a A T 2: 121,304,937 D2078V probably benign Het
Mgat4b G T 11: 50,230,685 V35L probably benign Het
Micu3 G A 8: 40,308,164 M38I probably benign Het
Myo15 A T 11: 60,496,415 H706L probably damaging Het
Ndc1 A G 4: 107,368,820 T42A probably benign Het
Nfat5 T A 8: 107,368,520 M1131K probably damaging Het
Nop14 G A 5: 34,641,440 S648L probably damaging Het
Olfr639 G T 7: 104,012,425 Y92* probably null Het
Otogl A G 10: 107,798,736 V1413A probably damaging Het
Palb2 T A 7: 122,112,001 M967L possibly damaging Het
Ppa2 A G 3: 133,348,143 K198R probably damaging Het
Prokr1 T C 6: 87,588,774 T30A probably benign Het
Prss50 C T 9: 110,858,060 R24C unknown Het
Rbm17 T C 2: 11,600,630 T38A possibly damaging Het
Rps6ka5 G A 12: 100,575,241 Q420* probably null Het
Senp6 G T 9: 80,118,512 R448L probably damaging Het
Senp7 T C 16: 56,179,028 I838T probably damaging Het
Sf3b2 C T 19: 5,287,214 S329N possibly damaging Het
Slc13a4 A T 6: 35,268,879 D610E probably benign Het
Slc24a2 A G 4: 87,227,100 L239P probably damaging Het
Slc39a5 T A 10: 128,397,015 H389L probably damaging Het
Syt4 A G 18: 31,444,019 L94P probably damaging Het
Tgm5 A G 2: 121,048,875 V560A probably benign Het
Tm7sf2 C T 19: 6,063,044 V376I probably benign Het
Tmem268 T A 4: 63,577,904 V194E probably damaging Het
Tpr C A 1: 150,414,813 R798S probably damaging Het
Trpv5 G T 6: 41,653,248 T685K possibly damaging Het
Ttn A T 2: 76,754,430 N22141K probably damaging Het
Txnrd2 T C 16: 18,456,298 I353T unknown Het
Upk1a A G 7: 30,603,618 Y252H probably damaging Het
Vmn2r118 A G 17: 55,608,642 I436T probably benign Het
Vmn2r76 T A 7: 86,225,271 I833F possibly damaging Het
Zfp277 T C 12: 40,329,578 H319R probably damaging Het
Other mutations in Thoc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Thoc5 APN 11 4918147 missense probably damaging 0.96
IGL02039:Thoc5 APN 11 4922027 critical splice donor site probably null
IGL02227:Thoc5 APN 11 4926217 missense probably benign 0.02
IGL02970:Thoc5 APN 11 4904201 missense probably damaging 0.99
R0398:Thoc5 UTSW 11 4921978 missense possibly damaging 0.84
R0401:Thoc5 UTSW 11 4902213 utr 5 prime probably benign
R0453:Thoc5 UTSW 11 4918217 missense possibly damaging 0.60
R1223:Thoc5 UTSW 11 4921922 missense probably benign 0.40
R1438:Thoc5 UTSW 11 4911427 splice site probably benign
R1661:Thoc5 UTSW 11 4919792 missense probably benign 0.04
R1665:Thoc5 UTSW 11 4919792 missense probably benign 0.04
R1776:Thoc5 UTSW 11 4914517 splice site probably benign
R1830:Thoc5 UTSW 11 4914608 missense probably benign 0.02
R1912:Thoc5 UTSW 11 4915561 missense probably benign 0.15
R3001:Thoc5 UTSW 11 4928688 missense probably benign
R3002:Thoc5 UTSW 11 4928688 missense probably benign
R3783:Thoc5 UTSW 11 4920372 unclassified probably benign
R4534:Thoc5 UTSW 11 4924807 nonsense probably null
R4619:Thoc5 UTSW 11 4926218 missense probably damaging 0.96
R4747:Thoc5 UTSW 11 4904187 missense probably damaging 0.99
R5106:Thoc5 UTSW 11 4910630 missense probably damaging 1.00
R5310:Thoc5 UTSW 11 4910648 missense probably damaging 1.00
R5914:Thoc5 UTSW 11 4920416 missense possibly damaging 0.58
R5936:Thoc5 UTSW 11 4904133 missense probably damaging 1.00
R6167:Thoc5 UTSW 11 4915497 missense probably benign 0.12
R6209:Thoc5 UTSW 11 4905697 missense probably damaging 1.00
R6243:Thoc5 UTSW 11 4919753 missense possibly damaging 0.59
R6504:Thoc5 UTSW 11 4924815 nonsense probably null
R6833:Thoc5 UTSW 11 4919804 missense probably damaging 1.00
R6874:Thoc5 UTSW 11 4901261 missense probably damaging 1.00
R7048:Thoc5 UTSW 11 4926237 critical splice donor site probably null
R7197:Thoc5 UTSW 11 4915563 missense probably benign 0.01
R7753:Thoc5 UTSW 11 4902156 missense probably damaging 0.99
R7828:Thoc5 UTSW 11 4902306 start gained probably benign
R8416:Thoc5 UTSW 11 4926068 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TTGTAGCCCAGCTGTGTACAG -3'
(R):5'- AGTCTTCTAGAGGACTGCGATC -3'

Sequencing Primer
(F):5'- CCAGCTGTGTACAGATCCTGTG -3'
(R):5'- AGAGGACTGCGATCTCTGTTCAC -3'
Posted On2020-10-20