Incidental Mutation 'R8428:Myo15a'
ID 653619
Institutional Source Beutler Lab
Gene Symbol Myo15a
Ensembl Gene ENSMUSG00000042678
Gene Name myosin XVA
Synonyms Myo15
MMRRC Submission 067822-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8428 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 60360165-60419195 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 60387241 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 706 (H706L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071880] [ENSMUST00000081823] [ENSMUST00000094135]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000071880
AA Change: H1875L

PolyPhen 2 Score 0.229 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000071777
Gene: ENSMUSG00000042678
AA Change: H1875L

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1955 1974 N/A INTRINSIC
low complexity region 1992 2006 N/A INTRINSIC
MyTH4 2049 2195 1.8e-42 SMART
low complexity region 2396 2405 N/A INTRINSIC
low complexity region 2451 2461 N/A INTRINSIC
Blast:MYSc 2665 2848 2e-14 BLAST
SH3 2851 2933 1.55e-4 SMART
low complexity region 2949 2962 N/A INTRINSIC
MyTH4 3031 3185 5.59e-48 SMART
B41 3188 3400 6.94e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000081823
AA Change: H688L

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000080507
Gene: ENSMUSG00000042678
AA Change: H688L

DomainStartEndE-ValueType
MYSc 13 697 N/A SMART
IQ 698 720 1.63e-1 SMART
IQ 721 743 1.77e-2 SMART
IQ 744 766 2.97e2 SMART
low complexity region 787 801 N/A INTRINSIC
MyTH4 844 990 1.8e-42 SMART
low complexity region 1191 1200 N/A INTRINSIC
low complexity region 1246 1256 N/A INTRINSIC
Blast:MYSc 1460 1643 7e-15 BLAST
SH3 1646 1728 1.55e-4 SMART
low complexity region 1744 1757 N/A INTRINSIC
MyTH4 1826 1980 5.59e-48 SMART
B41 1983 2195 6.94e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000094135
AA Change: H1875L

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000091686
Gene: ENSMUSG00000042678
AA Change: H1875L

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1974 1988 N/A INTRINSIC
MyTH4 2031 2177 1.8e-42 SMART
low complexity region 2378 2387 N/A INTRINSIC
low complexity region 2433 2443 N/A INTRINSIC
Blast:MYSc 2647 2830 2e-14 BLAST
SH3 2833 2915 1.55e-4 SMART
low complexity region 2931 2944 N/A INTRINSIC
MyTH4 3013 3167 5.59e-48 SMART
B41 3170 3382 6.94e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126522
AA Change: H706L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120839
Gene: ENSMUSG00000042678
AA Change: H706L

DomainStartEndE-ValueType
MYSc 34 716 N/A SMART
IQ 717 739 1.63e-1 SMART
IQ 740 762 1.77e-2 SMART
IQ 763 785 2.97e2 SMART
low complexity region 806 820 N/A INTRINSIC
MyTH4 863 1009 1.8e-42 SMART
low complexity region 1210 1219 N/A INTRINSIC
low complexity region 1265 1275 N/A INTRINSIC
Blast:MYSc 1479 1662 5e-15 BLAST
SH3 1665 1747 1.55e-4 SMART
low complexity region 1763 1776 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an unconventional myosin. This protein differs from other myosins in that it has a long N-terminal extension preceding the conserved motor domain. Studies in mice suggest that this protein is necessary for actin organization in the hair cells of the cochlea. Mutations in this gene have been associated with profound, congenital, neurosensory, nonsyndromal deafness. This gene is located within the Smith-Magenis syndrome region on chromosome 17. Read-through transcripts containing an upstream gene and this gene have been identified, but they are not thought to encode a fusion protein. Several alternatively spliced transcript variants have been described, but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in profound deafness and neurological behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 A G 10: 126,923,175 (GRCm39) I670V unknown Het
Bcan G T 3: 87,904,405 (GRCm39) T117K probably damaging Het
Bhlhe40 TG TGG 6: 108,641,818 (GRCm39) 254 probably null Het
Cbx8 C A 11: 118,929,754 (GRCm39) V280F probably damaging Het
Ccdc117 A T 11: 5,484,350 (GRCm39) S163R possibly damaging Het
Ccdc17 A T 4: 116,456,823 (GRCm39) I509F probably damaging Het
Cdon T C 9: 35,403,163 (GRCm39) V1091A probably benign Het
Cntnap5b C T 1: 100,311,310 (GRCm39) T972I probably damaging Het
Dlg2 T C 7: 90,740,240 (GRCm39) L9P possibly damaging Het
Dnah6 T A 6: 73,051,634 (GRCm39) R3053S probably benign Het
Dnah7a T A 1: 53,512,112 (GRCm39) N2983I probably damaging Het
Dnah7c T C 1: 46,711,536 (GRCm39) Y2588H probably damaging Het
Dpysl5 A G 5: 30,902,811 (GRCm39) D81G probably damaging Het
Dscaml1 A G 9: 45,653,884 (GRCm39) D1387G probably benign Het
Exd1 G T 2: 119,369,348 (GRCm39) T89K possibly damaging Het
Ezh2 T A 6: 47,522,745 (GRCm39) R364* probably null Het
Fam161b C T 12: 84,404,369 (GRCm39) D104N probably benign Het
Fbxw8 C A 5: 118,215,763 (GRCm39) V416L probably benign Het
Flnc A T 6: 29,450,849 (GRCm39) D1499V probably benign Het
Fmc1 A T 6: 38,516,115 (GRCm39) R54* probably null Het
Fzr1 A G 10: 81,206,942 (GRCm39) F61S probably damaging Het
Get4 T G 5: 139,251,393 (GRCm39) C160G probably benign Het
Gm32742 G A 9: 51,055,675 (GRCm39) R1330* probably null Het
Gnat3 G A 5: 18,220,312 (GRCm39) A225T possibly damaging Het
Gucy2c A G 6: 136,704,892 (GRCm39) Y541H probably damaging Het
Hand2 A G 8: 57,775,461 (GRCm39) T174A probably benign Het
Helb T C 10: 119,927,522 (GRCm39) T863A probably damaging Het
Hoxa7 A T 6: 52,194,993 (GRCm39) V2D unknown Het
Ifi44 G A 3: 151,444,978 (GRCm39) R325* probably null Het
Igfn1 C T 1: 135,895,520 (GRCm39) G1682E probably damaging Het
Itch A G 2: 155,010,627 (GRCm39) N32D probably benign Het
Kif26b T C 1: 178,744,923 (GRCm39) V1673A probably benign Het
Map1a A T 2: 121,135,418 (GRCm39) D2078V probably benign Het
Mgat4b G T 11: 50,121,512 (GRCm39) V35L probably benign Het
Micu3 G A 8: 40,761,205 (GRCm39) M38I probably benign Het
Ndc1 A G 4: 107,226,017 (GRCm39) T42A probably benign Het
Nfat5 T A 8: 108,095,152 (GRCm39) M1131K probably damaging Het
Nop14 G A 5: 34,798,784 (GRCm39) S648L probably damaging Het
Or51k1 G T 7: 103,661,632 (GRCm39) Y92* probably null Het
Otogl A G 10: 107,634,597 (GRCm39) V1413A probably damaging Het
Palb2 T A 7: 121,711,224 (GRCm39) M967L possibly damaging Het
Pira12 G A 7: 3,898,257 (GRCm39) T355I probably benign Het
Ppa2 A G 3: 133,053,904 (GRCm39) K198R probably damaging Het
Prokr1 T C 6: 87,565,756 (GRCm39) T30A probably benign Het
Prss50 C T 9: 110,687,128 (GRCm39) R24C unknown Het
Rbm17 T C 2: 11,605,441 (GRCm39) T38A possibly damaging Het
Rps6ka5 G A 12: 100,541,500 (GRCm39) Q420* probably null Het
Senp6 G T 9: 80,025,794 (GRCm39) R448L probably damaging Het
Senp7 T C 16: 55,999,391 (GRCm39) I838T probably damaging Het
Sf3b2 C T 19: 5,337,242 (GRCm39) S329N possibly damaging Het
Slc13a4 A T 6: 35,245,814 (GRCm39) D610E probably benign Het
Slc24a2 A G 4: 87,145,337 (GRCm39) L239P probably damaging Het
Slc39a5 T A 10: 128,232,884 (GRCm39) H389L probably damaging Het
Syt4 A G 18: 31,577,072 (GRCm39) L94P probably damaging Het
Tgm5 A G 2: 120,879,356 (GRCm39) V560A probably benign Het
Thoc5 A G 11: 4,876,115 (GRCm39) T623A probably damaging Het
Tm7sf2 C T 19: 6,113,074 (GRCm39) V376I probably benign Het
Tmem268 T A 4: 63,496,141 (GRCm39) V194E probably damaging Het
Tpr C A 1: 150,290,564 (GRCm39) R798S probably damaging Het
Trpv5 G T 6: 41,630,182 (GRCm39) T685K possibly damaging Het
Ttn A T 2: 76,584,774 (GRCm39) N22141K probably damaging Het
Txnrd2 T C 16: 18,275,048 (GRCm39) I353T unknown Het
Upk1a A G 7: 30,303,043 (GRCm39) Y252H probably damaging Het
Vmn2r118 A G 17: 55,915,642 (GRCm39) I436T probably benign Het
Vmn2r76 T A 7: 85,874,479 (GRCm39) I833F possibly damaging Het
Zfp277 T C 12: 40,379,577 (GRCm39) H319R probably damaging Het
Other mutations in Myo15a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00845:Myo15a APN 11 60,368,605 (GRCm39) missense probably damaging 1.00
IGL01011:Myo15a APN 11 60,367,818 (GRCm39) missense probably benign 0.33
IGL01100:Myo15a APN 11 60,401,984 (GRCm39) missense probably damaging 1.00
IGL01357:Myo15a APN 11 60,393,115 (GRCm39) splice site probably benign
IGL01634:Myo15a APN 11 60,386,298 (GRCm39) missense probably damaging 1.00
IGL01763:Myo15a APN 11 60,412,564 (GRCm39) missense probably benign 0.07
IGL01901:Myo15a APN 11 60,418,260 (GRCm39) utr 3 prime probably benign
IGL01931:Myo15a APN 11 60,386,964 (GRCm39) missense probably damaging 1.00
IGL02006:Myo15a APN 11 60,401,954 (GRCm39) missense probably damaging 1.00
IGL02041:Myo15a APN 11 60,397,689 (GRCm39) missense probably damaging 0.99
IGL02094:Myo15a APN 11 60,401,473 (GRCm39) unclassified probably benign
IGL02122:Myo15a APN 11 60,374,292 (GRCm39) missense probably benign 0.23
IGL02153:Myo15a APN 11 60,389,223 (GRCm39) missense probably damaging 1.00
IGL02328:Myo15a APN 11 60,417,433 (GRCm39) missense probably benign 0.13
IGL02330:Myo15a APN 11 60,367,987 (GRCm39) missense possibly damaging 0.94
IGL02431:Myo15a APN 11 60,401,465 (GRCm39) missense possibly damaging 0.73
IGL02639:Myo15a APN 11 60,369,447 (GRCm39) missense probably benign
IGL02659:Myo15a APN 11 60,382,609 (GRCm39) splice site probably benign
IGL02800:Myo15a APN 11 60,393,195 (GRCm39) missense probably damaging 1.00
IGL02812:Myo15a APN 11 60,368,005 (GRCm39) missense probably benign 0.15
IGL02863:Myo15a APN 11 60,368,953 (GRCm39) missense probably damaging 1.00
IGL02873:Myo15a APN 11 60,374,308 (GRCm39) missense probably damaging 1.00
IGL02990:Myo15a APN 11 60,370,266 (GRCm39) missense probably benign 0.02
IGL03011:Myo15a APN 11 60,400,357 (GRCm39) splice site probably benign
IGL03243:Myo15a APN 11 60,387,344 (GRCm39) missense probably damaging 1.00
IGL03297:Myo15a APN 11 60,369,967 (GRCm39) missense probably damaging 1.00
novichok UTSW 11 60,372,566 (GRCm39) critical splice donor site probably null
parker UTSW 11 60,411,740 (GRCm39) critical splice donor site probably null
Typhoon UTSW 11 60,378,251 (GRCm39) critical splice donor site probably null
PIT4131001:Myo15a UTSW 11 60,386,280 (GRCm39) missense probably damaging 1.00
PIT4131001:Myo15a UTSW 11 60,373,953 (GRCm39) missense probably damaging 1.00
R0133:Myo15a UTSW 11 60,368,676 (GRCm39) missense possibly damaging 0.94
R0265:Myo15a UTSW 11 60,405,723 (GRCm39) critical splice acceptor site probably null
R0389:Myo15a UTSW 11 60,369,364 (GRCm39) missense probably benign
R0416:Myo15a UTSW 11 60,402,000 (GRCm39) missense probably damaging 1.00
R0449:Myo15a UTSW 11 60,400,422 (GRCm39) missense possibly damaging 0.92
R0477:Myo15a UTSW 11 60,411,740 (GRCm39) critical splice donor site probably null
R0543:Myo15a UTSW 11 60,369,877 (GRCm39) missense probably benign
R0546:Myo15a UTSW 11 60,397,139 (GRCm39) missense probably damaging 1.00
R0555:Myo15a UTSW 11 60,412,464 (GRCm39) missense probably damaging 1.00
R0639:Myo15a UTSW 11 60,370,162 (GRCm39) missense probably benign 0.12
R0723:Myo15a UTSW 11 60,369,803 (GRCm39) missense possibly damaging 0.94
R0837:Myo15a UTSW 11 60,378,077 (GRCm39) missense probably damaging 0.98
R0865:Myo15a UTSW 11 60,382,514 (GRCm39) missense probably damaging 1.00
R0899:Myo15a UTSW 11 60,368,011 (GRCm39) missense possibly damaging 0.87
R1022:Myo15a UTSW 11 60,370,442 (GRCm39) missense probably benign 0.00
R1024:Myo15a UTSW 11 60,370,442 (GRCm39) missense probably benign 0.00
R1035:Myo15a UTSW 11 60,401,384 (GRCm39) unclassified probably benign
R1109:Myo15a UTSW 11 60,383,892 (GRCm39) missense probably damaging 1.00
R1170:Myo15a UTSW 11 60,370,233 (GRCm39) missense probably benign 0.04
R1241:Myo15a UTSW 11 60,390,256 (GRCm39) missense possibly damaging 0.58
R1392:Myo15a UTSW 11 60,368,800 (GRCm39) missense possibly damaging 0.95
R1392:Myo15a UTSW 11 60,368,800 (GRCm39) missense possibly damaging 0.95
R1434:Myo15a UTSW 11 60,395,157 (GRCm39) missense probably benign 0.00
R1450:Myo15a UTSW 11 60,386,308 (GRCm39) missense probably damaging 1.00
R1456:Myo15a UTSW 11 60,399,028 (GRCm39) missense probably damaging 1.00
R1468:Myo15a UTSW 11 60,396,832 (GRCm39) missense probably damaging 1.00
R1468:Myo15a UTSW 11 60,396,832 (GRCm39) missense probably damaging 1.00
R1548:Myo15a UTSW 11 60,379,064 (GRCm39) missense probably damaging 1.00
R1551:Myo15a UTSW 11 60,383,791 (GRCm39) missense possibly damaging 0.70
R1571:Myo15a UTSW 11 60,409,290 (GRCm39) missense probably damaging 1.00
R1662:Myo15a UTSW 11 60,392,527 (GRCm39) missense probably damaging 1.00
R1777:Myo15a UTSW 11 60,405,762 (GRCm39) missense probably benign
R1778:Myo15a UTSW 11 60,369,238 (GRCm39) missense possibly damaging 0.57
R1847:Myo15a UTSW 11 60,390,321 (GRCm39) nonsense probably null
R1875:Myo15a UTSW 11 60,398,354 (GRCm39) missense probably damaging 0.99
R1944:Myo15a UTSW 11 60,392,909 (GRCm39) missense probably damaging 0.99
R1945:Myo15a UTSW 11 60,392,909 (GRCm39) missense probably damaging 0.99
R2013:Myo15a UTSW 11 60,385,057 (GRCm39) missense probably damaging 1.00
R2107:Myo15a UTSW 11 60,382,636 (GRCm39) missense probably damaging 1.00
R2108:Myo15a UTSW 11 60,382,636 (GRCm39) missense probably damaging 1.00
R2112:Myo15a UTSW 11 60,384,994 (GRCm39) missense probably damaging 0.99
R2147:Myo15a UTSW 11 60,401,055 (GRCm39) missense possibly damaging 0.66
R2196:Myo15a UTSW 11 60,400,847 (GRCm39) nonsense probably null
R2207:Myo15a UTSW 11 60,396,860 (GRCm39) missense probably benign 0.01
R2245:Myo15a UTSW 11 60,399,925 (GRCm39) missense probably damaging 1.00
R2367:Myo15a UTSW 11 60,408,064 (GRCm39) missense probably damaging 0.99
R2374:Myo15a UTSW 11 60,369,669 (GRCm39) missense possibly damaging 0.88
R2438:Myo15a UTSW 11 60,373,878 (GRCm39) missense probably damaging 1.00
R3154:Myo15a UTSW 11 60,370,186 (GRCm39) splice site probably null
R3423:Myo15a UTSW 11 60,401,126 (GRCm39) critical splice donor site probably null
R3551:Myo15a UTSW 11 60,400,489 (GRCm39) missense possibly damaging 0.93
R3552:Myo15a UTSW 11 60,400,489 (GRCm39) missense possibly damaging 0.93
R3612:Myo15a UTSW 11 60,368,505 (GRCm39) missense probably damaging 1.00
R3620:Myo15a UTSW 11 60,369,468 (GRCm39) missense possibly damaging 0.63
R3713:Myo15a UTSW 11 60,370,057 (GRCm39) missense possibly damaging 0.55
R3714:Myo15a UTSW 11 60,370,057 (GRCm39) missense possibly damaging 0.55
R3715:Myo15a UTSW 11 60,370,057 (GRCm39) missense possibly damaging 0.55
R3783:Myo15a UTSW 11 60,368,398 (GRCm39) missense probably damaging 0.97
R3784:Myo15a UTSW 11 60,368,398 (GRCm39) missense probably damaging 0.97
R3785:Myo15a UTSW 11 60,368,398 (GRCm39) missense probably damaging 0.97
R3786:Myo15a UTSW 11 60,368,398 (GRCm39) missense probably damaging 0.97
R3787:Myo15a UTSW 11 60,368,398 (GRCm39) missense probably damaging 0.97
R3894:Myo15a UTSW 11 60,395,145 (GRCm39) missense probably benign 0.00
R3962:Myo15a UTSW 11 60,370,654 (GRCm39) missense probably benign 0.00
R4082:Myo15a UTSW 11 60,378,022 (GRCm39) missense possibly damaging 0.92
R4555:Myo15a UTSW 11 60,387,763 (GRCm39) missense probably damaging 1.00
R4641:Myo15a UTSW 11 60,393,867 (GRCm39) missense probably damaging 1.00
R4665:Myo15a UTSW 11 60,395,705 (GRCm39) critical splice acceptor site probably null
R4713:Myo15a UTSW 11 60,370,756 (GRCm39) missense probably benign 0.21
R4820:Myo15a UTSW 11 60,367,741 (GRCm39) missense probably damaging 0.98
R5013:Myo15a UTSW 11 60,382,493 (GRCm39) missense probably damaging 1.00
R5051:Myo15a UTSW 11 60,378,251 (GRCm39) critical splice donor site probably null
R5187:Myo15a UTSW 11 60,394,440 (GRCm39) missense probably damaging 1.00
R5230:Myo15a UTSW 11 60,393,674 (GRCm39) missense possibly damaging 0.68
R5277:Myo15a UTSW 11 60,367,940 (GRCm39) nonsense probably null
R5345:Myo15a UTSW 11 60,388,364 (GRCm39) missense probably damaging 0.99
R5349:Myo15a UTSW 11 60,384,409 (GRCm39) missense probably damaging 1.00
R5356:Myo15a UTSW 11 60,389,192 (GRCm39) missense probably damaging 1.00
R5445:Myo15a UTSW 11 60,411,603 (GRCm39) nonsense probably null
R5477:Myo15a UTSW 11 60,368,503 (GRCm39) missense probably damaging 1.00
R5629:Myo15a UTSW 11 60,370,578 (GRCm39) missense probably benign
R5728:Myo15a UTSW 11 60,379,722 (GRCm39) missense probably damaging 1.00
R5818:Myo15a UTSW 11 60,388,777 (GRCm39) missense probably benign 0.06
R5952:Myo15a UTSW 11 60,370,246 (GRCm39) missense possibly damaging 0.50
R6338:Myo15a UTSW 11 60,368,959 (GRCm39) missense probably damaging 0.99
R6467:Myo15a UTSW 11 60,417,487 (GRCm39) critical splice donor site probably null
R6488:Myo15a UTSW 11 60,369,313 (GRCm39) missense possibly damaging 0.86
R6521:Myo15a UTSW 11 60,393,195 (GRCm39) missense probably damaging 1.00
R6645:Myo15a UTSW 11 60,368,118 (GRCm39) missense probably benign 0.00
R6702:Myo15a UTSW 11 60,383,818 (GRCm39) missense probably benign 0.16
R6703:Myo15a UTSW 11 60,383,818 (GRCm39) missense probably benign 0.16
R6821:Myo15a UTSW 11 60,415,301 (GRCm39) missense probably damaging 1.00
R6882:Myo15a UTSW 11 60,414,832 (GRCm39) missense probably damaging 1.00
R6908:Myo15a UTSW 11 60,396,832 (GRCm39) missense probably damaging 1.00
R6932:Myo15a UTSW 11 60,390,320 (GRCm39) missense probably damaging 1.00
R6958:Myo15a UTSW 11 60,394,451 (GRCm39) missense probably benign 0.07
R7041:Myo15a UTSW 11 60,396,832 (GRCm39) missense probably damaging 1.00
R7149:Myo15a UTSW 11 60,400,836 (GRCm39) missense possibly damaging 0.56
R7163:Myo15a UTSW 11 60,389,195 (GRCm39) missense
R7229:Myo15a UTSW 11 60,387,321 (GRCm39) missense probably benign 0.08
R7347:Myo15a UTSW 11 60,368,787 (GRCm39) missense probably benign
R7368:Myo15a UTSW 11 60,381,741 (GRCm39) splice site probably null
R7392:Myo15a UTSW 11 60,396,802 (GRCm39) missense
R7414:Myo15a UTSW 11 60,374,309 (GRCm39) missense
R7461:Myo15a UTSW 11 60,395,978 (GRCm39) missense
R7609:Myo15a UTSW 11 60,379,637 (GRCm39) missense
R7613:Myo15a UTSW 11 60,395,978 (GRCm39) missense
R7734:Myo15a UTSW 11 60,401,108 (GRCm39) missense probably benign
R7748:Myo15a UTSW 11 60,395,727 (GRCm39) missense
R7767:Myo15a UTSW 11 60,392,922 (GRCm39) missense
R7769:Myo15a UTSW 11 60,399,975 (GRCm39) missense
R7894:Myo15a UTSW 11 60,381,963 (GRCm39) missense
R7919:Myo15a UTSW 11 60,417,356 (GRCm39) missense probably damaging 1.00
R8100:Myo15a UTSW 11 60,408,016 (GRCm39) missense probably damaging 1.00
R8124:Myo15a UTSW 11 60,398,279 (GRCm39) missense
R8129:Myo15a UTSW 11 60,399,026 (GRCm39) missense
R8706:Myo15a UTSW 11 60,370,443 (GRCm39) missense probably benign
R8735:Myo15a UTSW 11 60,401,679 (GRCm39) critical splice acceptor site probably null
R8739:Myo15a UTSW 11 60,368,088 (GRCm39) missense probably benign 0.06
R8790:Myo15a UTSW 11 60,378,047 (GRCm39) missense
R8790:Myo15a UTSW 11 60,367,362 (GRCm39) missense possibly damaging 0.73
R8822:Myo15a UTSW 11 60,367,740 (GRCm39) missense probably damaging 0.99
R8907:Myo15a UTSW 11 60,417,434 (GRCm39) missense
R8931:Myo15a UTSW 11 60,368,020 (GRCm39) missense probably benign
R9061:Myo15a UTSW 11 60,393,692 (GRCm39) missense
R9124:Myo15a UTSW 11 60,369,952 (GRCm39) missense probably benign 0.37
R9297:Myo15a UTSW 11 60,385,899 (GRCm39) missense probably null
R9347:Myo15a UTSW 11 60,374,555 (GRCm39) missense
R9417:Myo15a UTSW 11 60,378,243 (GRCm39) missense
R9456:Myo15a UTSW 11 60,392,668 (GRCm39) missense
R9460:Myo15a UTSW 11 60,372,566 (GRCm39) critical splice donor site probably null
R9615:Myo15a UTSW 11 60,374,320 (GRCm39) missense
R9630:Myo15a UTSW 11 60,407,988 (GRCm39) missense probably damaging 1.00
R9746:Myo15a UTSW 11 60,378,234 (GRCm39) nonsense probably null
X0021:Myo15a UTSW 11 60,373,185 (GRCm39) nonsense probably null
X0066:Myo15a UTSW 11 60,369,046 (GRCm39) missense probably damaging 1.00
X0067:Myo15a UTSW 11 60,369,444 (GRCm39) missense possibly damaging 0.88
Z1176:Myo15a UTSW 11 60,389,229 (GRCm39) missense
Z1176:Myo15a UTSW 11 60,379,084 (GRCm39) missense
Z1176:Myo15a UTSW 11 60,415,267 (GRCm39) missense probably damaging 1.00
Z1177:Myo15a UTSW 11 60,386,301 (GRCm39) missense
Z1177:Myo15a UTSW 11 60,379,663 (GRCm39) missense
Z1177:Myo15a UTSW 11 60,368,349 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCGCATTCAGTGATATCC -3'
(R):5'- GAGACTGTCCCTTCTGCATG -3'

Sequencing Primer
(F):5'- CCGCATTCAGTGATATCCAAGGG -3'
(R):5'- CTGCATGCCTCACCTGG -3'
Posted On 2020-10-20