Incidental Mutation 'R8428:Vmn2r118'
ID 653626
Institutional Source Beutler Lab
Gene Symbol Vmn2r118
Ensembl Gene ENSMUSG00000091504
Gene Name vomeronasal 2, receptor 118
Synonyms Vmn2r119, EG668547, EG383258
MMRRC Submission 067822-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.128) question?
Stock # R8428 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 55899341-55931672 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 55915642 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 436 (I436T)
Ref Sequence ENSEMBL: ENSMUSP00000131128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168440]
AlphaFold E9Q1C1
Predicted Effect probably benign
Transcript: ENSMUST00000168440
AA Change: I436T

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131128
Gene: ENSMUSG00000091504
AA Change: I436T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 142 470 4.6e-27 PFAM
Pfam:NCD3G 513 566 2.6e-20 PFAM
Pfam:7tm_3 599 834 5.9e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 A G 10: 126,923,175 (GRCm39) I670V unknown Het
Bcan G T 3: 87,904,405 (GRCm39) T117K probably damaging Het
Bhlhe40 TG TGG 6: 108,641,818 (GRCm39) 254 probably null Het
Cbx8 C A 11: 118,929,754 (GRCm39) V280F probably damaging Het
Ccdc117 A T 11: 5,484,350 (GRCm39) S163R possibly damaging Het
Ccdc17 A T 4: 116,456,823 (GRCm39) I509F probably damaging Het
Cdon T C 9: 35,403,163 (GRCm39) V1091A probably benign Het
Cntnap5b C T 1: 100,311,310 (GRCm39) T972I probably damaging Het
Dlg2 T C 7: 90,740,240 (GRCm39) L9P possibly damaging Het
Dnah6 T A 6: 73,051,634 (GRCm39) R3053S probably benign Het
Dnah7a T A 1: 53,512,112 (GRCm39) N2983I probably damaging Het
Dnah7c T C 1: 46,711,536 (GRCm39) Y2588H probably damaging Het
Dpysl5 A G 5: 30,902,811 (GRCm39) D81G probably damaging Het
Dscaml1 A G 9: 45,653,884 (GRCm39) D1387G probably benign Het
Exd1 G T 2: 119,369,348 (GRCm39) T89K possibly damaging Het
Ezh2 T A 6: 47,522,745 (GRCm39) R364* probably null Het
Fam161b C T 12: 84,404,369 (GRCm39) D104N probably benign Het
Fbxw8 C A 5: 118,215,763 (GRCm39) V416L probably benign Het
Flnc A T 6: 29,450,849 (GRCm39) D1499V probably benign Het
Fmc1 A T 6: 38,516,115 (GRCm39) R54* probably null Het
Fzr1 A G 10: 81,206,942 (GRCm39) F61S probably damaging Het
Get4 T G 5: 139,251,393 (GRCm39) C160G probably benign Het
Gm32742 G A 9: 51,055,675 (GRCm39) R1330* probably null Het
Gnat3 G A 5: 18,220,312 (GRCm39) A225T possibly damaging Het
Gucy2c A G 6: 136,704,892 (GRCm39) Y541H probably damaging Het
Hand2 A G 8: 57,775,461 (GRCm39) T174A probably benign Het
Helb T C 10: 119,927,522 (GRCm39) T863A probably damaging Het
Hoxa7 A T 6: 52,194,993 (GRCm39) V2D unknown Het
Ifi44 G A 3: 151,444,978 (GRCm39) R325* probably null Het
Igfn1 C T 1: 135,895,520 (GRCm39) G1682E probably damaging Het
Itch A G 2: 155,010,627 (GRCm39) N32D probably benign Het
Kif26b T C 1: 178,744,923 (GRCm39) V1673A probably benign Het
Map1a A T 2: 121,135,418 (GRCm39) D2078V probably benign Het
Mgat4b G T 11: 50,121,512 (GRCm39) V35L probably benign Het
Micu3 G A 8: 40,761,205 (GRCm39) M38I probably benign Het
Myo15a A T 11: 60,387,241 (GRCm39) H706L probably damaging Het
Ndc1 A G 4: 107,226,017 (GRCm39) T42A probably benign Het
Nfat5 T A 8: 108,095,152 (GRCm39) M1131K probably damaging Het
Nop14 G A 5: 34,798,784 (GRCm39) S648L probably damaging Het
Or51k1 G T 7: 103,661,632 (GRCm39) Y92* probably null Het
Otogl A G 10: 107,634,597 (GRCm39) V1413A probably damaging Het
Palb2 T A 7: 121,711,224 (GRCm39) M967L possibly damaging Het
Pira12 G A 7: 3,898,257 (GRCm39) T355I probably benign Het
Ppa2 A G 3: 133,053,904 (GRCm39) K198R probably damaging Het
Prokr1 T C 6: 87,565,756 (GRCm39) T30A probably benign Het
Prss50 C T 9: 110,687,128 (GRCm39) R24C unknown Het
Rbm17 T C 2: 11,605,441 (GRCm39) T38A possibly damaging Het
Rps6ka5 G A 12: 100,541,500 (GRCm39) Q420* probably null Het
Senp6 G T 9: 80,025,794 (GRCm39) R448L probably damaging Het
Senp7 T C 16: 55,999,391 (GRCm39) I838T probably damaging Het
Sf3b2 C T 19: 5,337,242 (GRCm39) S329N possibly damaging Het
Slc13a4 A T 6: 35,245,814 (GRCm39) D610E probably benign Het
Slc24a2 A G 4: 87,145,337 (GRCm39) L239P probably damaging Het
Slc39a5 T A 10: 128,232,884 (GRCm39) H389L probably damaging Het
Syt4 A G 18: 31,577,072 (GRCm39) L94P probably damaging Het
Tgm5 A G 2: 120,879,356 (GRCm39) V560A probably benign Het
Thoc5 A G 11: 4,876,115 (GRCm39) T623A probably damaging Het
Tm7sf2 C T 19: 6,113,074 (GRCm39) V376I probably benign Het
Tmem268 T A 4: 63,496,141 (GRCm39) V194E probably damaging Het
Tpr C A 1: 150,290,564 (GRCm39) R798S probably damaging Het
Trpv5 G T 6: 41,630,182 (GRCm39) T685K possibly damaging Het
Ttn A T 2: 76,584,774 (GRCm39) N22141K probably damaging Het
Txnrd2 T C 16: 18,275,048 (GRCm39) I353T unknown Het
Upk1a A G 7: 30,303,043 (GRCm39) Y252H probably damaging Het
Vmn2r76 T A 7: 85,874,479 (GRCm39) I833F possibly damaging Het
Zfp277 T C 12: 40,379,577 (GRCm39) H319R probably damaging Het
Other mutations in Vmn2r118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Vmn2r118 APN 17 55,899,708 (GRCm39) missense probably damaging 1.00
IGL00976:Vmn2r118 APN 17 55,900,204 (GRCm39) missense probably damaging 1.00
IGL01419:Vmn2r118 APN 17 55,900,000 (GRCm39) missense probably benign 0.01
IGL01796:Vmn2r118 APN 17 55,915,585 (GRCm39) missense probably benign 0.30
IGL01799:Vmn2r118 APN 17 55,899,990 (GRCm39) missense probably damaging 1.00
IGL02002:Vmn2r118 APN 17 55,899,619 (GRCm39) missense probably damaging 1.00
IGL02075:Vmn2r118 APN 17 55,917,517 (GRCm39) missense probably benign 0.18
IGL02172:Vmn2r118 APN 17 55,931,598 (GRCm39) missense probably benign 0.00
IGL02529:Vmn2r118 APN 17 55,917,870 (GRCm39) missense possibly damaging 0.58
IGL02712:Vmn2r118 APN 17 55,899,655 (GRCm39) missense probably benign 0.21
IGL03096:Vmn2r118 APN 17 55,914,996 (GRCm39) missense probably damaging 1.00
R0306:Vmn2r118 UTSW 17 55,915,616 (GRCm39) missense possibly damaging 0.89
R0329:Vmn2r118 UTSW 17 55,917,717 (GRCm39) missense probably damaging 1.00
R0330:Vmn2r118 UTSW 17 55,917,717 (GRCm39) missense probably damaging 1.00
R0396:Vmn2r118 UTSW 17 55,915,643 (GRCm39) missense probably benign 0.00
R0411:Vmn2r118 UTSW 17 55,918,021 (GRCm39) splice site probably benign
R0513:Vmn2r118 UTSW 17 55,917,970 (GRCm39) nonsense probably null
R0627:Vmn2r118 UTSW 17 55,917,772 (GRCm39) missense probably benign 0.01
R0638:Vmn2r118 UTSW 17 55,915,466 (GRCm39) missense probably benign 0.03
R1328:Vmn2r118 UTSW 17 55,915,620 (GRCm39) missense probably benign 0.01
R1366:Vmn2r118 UTSW 17 55,900,237 (GRCm39) nonsense probably null
R1465:Vmn2r118 UTSW 17 55,917,935 (GRCm39) missense probably benign 0.33
R1465:Vmn2r118 UTSW 17 55,917,935 (GRCm39) missense probably benign 0.33
R1511:Vmn2r118 UTSW 17 55,915,496 (GRCm39) nonsense probably null
R1515:Vmn2r118 UTSW 17 55,917,643 (GRCm39) missense probably benign 0.25
R1550:Vmn2r118 UTSW 17 55,915,083 (GRCm39) missense probably damaging 1.00
R1779:Vmn2r118 UTSW 17 55,918,530 (GRCm39) missense probably benign 0.03
R1834:Vmn2r118 UTSW 17 55,899,456 (GRCm39) missense probably damaging 1.00
R1840:Vmn2r118 UTSW 17 55,917,406 (GRCm39) nonsense probably null
R1854:Vmn2r118 UTSW 17 55,918,556 (GRCm39) missense possibly damaging 0.57
R1967:Vmn2r118 UTSW 17 55,899,882 (GRCm39) missense probably damaging 1.00
R1976:Vmn2r118 UTSW 17 55,899,925 (GRCm39) missense probably damaging 1.00
R2308:Vmn2r118 UTSW 17 55,931,650 (GRCm39) missense probably benign 0.33
R3700:Vmn2r118 UTSW 17 55,915,421 (GRCm39) missense possibly damaging 0.68
R4334:Vmn2r118 UTSW 17 55,917,347 (GRCm39) missense possibly damaging 0.58
R4647:Vmn2r118 UTSW 17 55,917,665 (GRCm39) missense probably damaging 1.00
R4709:Vmn2r118 UTSW 17 55,917,860 (GRCm39) missense probably damaging 1.00
R4805:Vmn2r118 UTSW 17 55,899,581 (GRCm39) missense probably damaging 1.00
R4858:Vmn2r118 UTSW 17 55,899,894 (GRCm39) missense probably damaging 0.98
R5384:Vmn2r118 UTSW 17 55,918,565 (GRCm39) missense probably benign 0.00
R5385:Vmn2r118 UTSW 17 55,918,565 (GRCm39) missense probably benign 0.00
R5664:Vmn2r118 UTSW 17 55,899,765 (GRCm39) missense possibly damaging 0.46
R5740:Vmn2r118 UTSW 17 55,900,103 (GRCm39) missense probably benign 0.00
R5927:Vmn2r118 UTSW 17 55,931,494 (GRCm39) missense probably benign 0.04
R6143:Vmn2r118 UTSW 17 55,899,871 (GRCm39) missense possibly damaging 0.92
R6513:Vmn2r118 UTSW 17 55,915,093 (GRCm39) missense probably damaging 1.00
R6573:Vmn2r118 UTSW 17 55,899,996 (GRCm39) missense probably damaging 1.00
R6760:Vmn2r118 UTSW 17 55,899,714 (GRCm39) missense possibly damaging 0.92
R6794:Vmn2r118 UTSW 17 55,899,348 (GRCm39) missense possibly damaging 0.48
R6929:Vmn2r118 UTSW 17 55,917,440 (GRCm39) missense probably benign 0.01
R7201:Vmn2r118 UTSW 17 55,915,496 (GRCm39) nonsense probably null
R7539:Vmn2r118 UTSW 17 55,899,853 (GRCm39) missense probably damaging 0.98
R7836:Vmn2r118 UTSW 17 55,900,242 (GRCm39) missense probably damaging 0.99
R8179:Vmn2r118 UTSW 17 55,915,484 (GRCm39) missense probably benign 0.36
R8248:Vmn2r118 UTSW 17 55,917,936 (GRCm39) missense probably benign 0.18
R8347:Vmn2r118 UTSW 17 55,917,423 (GRCm39) missense possibly damaging 0.94
R8415:Vmn2r118 UTSW 17 55,915,057 (GRCm39) missense probably benign 0.08
R8917:Vmn2r118 UTSW 17 55,917,216 (GRCm39) missense possibly damaging 0.82
R8993:Vmn2r118 UTSW 17 55,917,835 (GRCm39) missense possibly damaging 0.72
R9038:Vmn2r118 UTSW 17 55,918,649 (GRCm39) missense probably damaging 1.00
R9155:Vmn2r118 UTSW 17 55,917,207 (GRCm39) missense probably null 0.83
R9603:Vmn2r118 UTSW 17 55,899,837 (GRCm39) missense probably damaging 1.00
R9742:Vmn2r118 UTSW 17 55,918,009 (GRCm39) missense probably damaging 0.98
R9749:Vmn2r118 UTSW 17 55,915,415 (GRCm39) critical splice donor site probably null
R9792:Vmn2r118 UTSW 17 55,899,496 (GRCm39) missense probably damaging 0.99
R9793:Vmn2r118 UTSW 17 55,899,496 (GRCm39) missense probably damaging 0.99
R9795:Vmn2r118 UTSW 17 55,899,496 (GRCm39) missense probably damaging 0.99
X0022:Vmn2r118 UTSW 17 55,900,218 (GRCm39) missense probably damaging 1.00
Z1176:Vmn2r118 UTSW 17 55,917,655 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGGCCCATTGGATCATGTC -3'
(R):5'- CTGACTCAGTGCAATACCCATC -3'

Sequencing Primer
(F):5'- CAAGCCCTTGTGGAAAATT -3'
(R):5'- CAGCATGTAAAAGAAGGCTAATTTG -3'
Posted On 2020-10-20