Incidental Mutation 'R8428:Vmn2r118'
ID653626
Institutional Source Beutler Lab
Gene Symbol Vmn2r118
Ensembl Gene ENSMUSG00000091504
Gene Namevomeronasal 2, receptor 118
SynonymsEG383258, Vmn2r119, EG668547
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R8428 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location55592341-55624672 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55608642 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 436 (I436T)
Ref Sequence ENSEMBL: ENSMUSP00000131128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168440]
Predicted Effect probably benign
Transcript: ENSMUST00000168440
AA Change: I436T

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131128
Gene: ENSMUSG00000091504
AA Change: I436T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 142 470 4.6e-27 PFAM
Pfam:NCD3G 513 566 2.6e-20 PFAM
Pfam:7tm_3 599 834 5.9e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 A G 10: 127,087,306 I670V unknown Het
Bcan G T 3: 87,997,098 T117K probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cbx8 C A 11: 119,038,928 V280F probably damaging Het
Ccdc117 A T 11: 5,534,350 S163R possibly damaging Het
Ccdc17 A T 4: 116,599,626 I509F probably damaging Het
Cdon T C 9: 35,491,867 V1091A probably benign Het
Cntnap5b C T 1: 100,383,585 T972I probably damaging Het
Dlg2 T C 7: 91,091,032 L9P possibly damaging Het
Dnah6 T A 6: 73,074,651 R3053S probably benign Het
Dnah7a T A 1: 53,472,953 N2983I probably damaging Het
Dnah7c T C 1: 46,672,376 Y2588H probably damaging Het
Dpysl5 A G 5: 30,745,467 D81G probably damaging Het
Dscaml1 A G 9: 45,742,586 D1387G probably benign Het
Exd1 G T 2: 119,538,867 T89K possibly damaging Het
Ezh2 T A 6: 47,545,811 R364* probably null Het
Fam161b C T 12: 84,357,595 D104N probably benign Het
Fbxw8 C A 5: 118,077,698 V416L probably benign Het
Flnc A T 6: 29,450,850 D1499V probably benign Het
Fmc1 A T 6: 38,539,180 R54* probably null Het
Fzr1 A G 10: 81,371,108 F61S probably damaging Het
Get4 T G 5: 139,265,638 C160G probably benign Het
Gm14548 G A 7: 3,895,258 T355I probably benign Het
Gm32742 G A 9: 51,144,375 R1330* probably null Het
Gnat3 G A 5: 18,015,314 A225T possibly damaging Het
Gucy2c A G 6: 136,727,894 Y541H probably damaging Het
Hand2 A G 8: 57,322,426 T174A probably benign Het
Helb T C 10: 120,091,617 T863A probably damaging Het
Hoxa7 A T 6: 52,218,013 V2D unknown Het
Ifi44 G A 3: 151,739,341 R325* probably null Het
Igfn1 C T 1: 135,967,782 G1682E probably damaging Het
Itch A G 2: 155,168,707 N32D probably benign Het
Kif26b T C 1: 178,917,358 V1673A probably benign Het
Map1a A T 2: 121,304,937 D2078V probably benign Het
Mgat4b G T 11: 50,230,685 V35L probably benign Het
Micu3 G A 8: 40,308,164 M38I probably benign Het
Myo15 A T 11: 60,496,415 H706L probably damaging Het
Ndc1 A G 4: 107,368,820 T42A probably benign Het
Nfat5 T A 8: 107,368,520 M1131K probably damaging Het
Nop14 G A 5: 34,641,440 S648L probably damaging Het
Olfr639 G T 7: 104,012,425 Y92* probably null Het
Otogl A G 10: 107,798,736 V1413A probably damaging Het
Palb2 T A 7: 122,112,001 M967L possibly damaging Het
Ppa2 A G 3: 133,348,143 K198R probably damaging Het
Prokr1 T C 6: 87,588,774 T30A probably benign Het
Prss50 C T 9: 110,858,060 R24C unknown Het
Rbm17 T C 2: 11,600,630 T38A possibly damaging Het
Rps6ka5 G A 12: 100,575,241 Q420* probably null Het
Senp6 G T 9: 80,118,512 R448L probably damaging Het
Senp7 T C 16: 56,179,028 I838T probably damaging Het
Sf3b2 C T 19: 5,287,214 S329N possibly damaging Het
Slc13a4 A T 6: 35,268,879 D610E probably benign Het
Slc24a2 A G 4: 87,227,100 L239P probably damaging Het
Slc39a5 T A 10: 128,397,015 H389L probably damaging Het
Syt4 A G 18: 31,444,019 L94P probably damaging Het
Tgm5 A G 2: 121,048,875 V560A probably benign Het
Thoc5 A G 11: 4,926,115 T623A probably damaging Het
Tm7sf2 C T 19: 6,063,044 V376I probably benign Het
Tmem268 T A 4: 63,577,904 V194E probably damaging Het
Tpr C A 1: 150,414,813 R798S probably damaging Het
Trpv5 G T 6: 41,653,248 T685K possibly damaging Het
Ttn A T 2: 76,754,430 N22141K probably damaging Het
Txnrd2 T C 16: 18,456,298 I353T unknown Het
Upk1a A G 7: 30,603,618 Y252H probably damaging Het
Vmn2r76 T A 7: 86,225,271 I833F possibly damaging Het
Zfp277 T C 12: 40,329,578 H319R probably damaging Het
Other mutations in Vmn2r118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Vmn2r118 APN 17 55592708 missense probably damaging 1.00
IGL00976:Vmn2r118 APN 17 55593204 missense probably damaging 1.00
IGL01419:Vmn2r118 APN 17 55593000 missense probably benign 0.01
IGL01796:Vmn2r118 APN 17 55608585 missense probably benign 0.30
IGL01799:Vmn2r118 APN 17 55592990 missense probably damaging 1.00
IGL02002:Vmn2r118 APN 17 55592619 missense probably damaging 1.00
IGL02075:Vmn2r118 APN 17 55610517 missense probably benign 0.18
IGL02172:Vmn2r118 APN 17 55624598 missense probably benign 0.00
IGL02529:Vmn2r118 APN 17 55610870 missense possibly damaging 0.58
IGL02712:Vmn2r118 APN 17 55592655 missense probably benign 0.21
IGL03096:Vmn2r118 APN 17 55607996 missense probably damaging 1.00
R0306:Vmn2r118 UTSW 17 55608616 missense possibly damaging 0.89
R0329:Vmn2r118 UTSW 17 55610717 missense probably damaging 1.00
R0330:Vmn2r118 UTSW 17 55610717 missense probably damaging 1.00
R0396:Vmn2r118 UTSW 17 55608643 missense probably benign 0.00
R0411:Vmn2r118 UTSW 17 55611021 splice site probably benign
R0513:Vmn2r118 UTSW 17 55610970 nonsense probably null
R0627:Vmn2r118 UTSW 17 55610772 missense probably benign 0.01
R0638:Vmn2r118 UTSW 17 55608466 missense probably benign 0.03
R1328:Vmn2r118 UTSW 17 55608620 missense probably benign 0.01
R1366:Vmn2r118 UTSW 17 55593237 nonsense probably null
R1465:Vmn2r118 UTSW 17 55610935 missense probably benign 0.33
R1465:Vmn2r118 UTSW 17 55610935 missense probably benign 0.33
R1511:Vmn2r118 UTSW 17 55608496 nonsense probably null
R1515:Vmn2r118 UTSW 17 55610643 missense probably benign 0.25
R1550:Vmn2r118 UTSW 17 55608083 missense probably damaging 1.00
R1779:Vmn2r118 UTSW 17 55611530 missense probably benign 0.03
R1834:Vmn2r118 UTSW 17 55592456 missense probably damaging 1.00
R1840:Vmn2r118 UTSW 17 55610406 nonsense probably null
R1854:Vmn2r118 UTSW 17 55611556 missense possibly damaging 0.57
R1967:Vmn2r118 UTSW 17 55592882 missense probably damaging 1.00
R1976:Vmn2r118 UTSW 17 55592925 missense probably damaging 1.00
R2308:Vmn2r118 UTSW 17 55624650 missense probably benign 0.33
R3700:Vmn2r118 UTSW 17 55608421 missense possibly damaging 0.68
R4334:Vmn2r118 UTSW 17 55610347 missense possibly damaging 0.58
R4647:Vmn2r118 UTSW 17 55610665 missense probably damaging 1.00
R4709:Vmn2r118 UTSW 17 55610860 missense probably damaging 1.00
R4805:Vmn2r118 UTSW 17 55592581 missense probably damaging 1.00
R4858:Vmn2r118 UTSW 17 55592894 missense probably damaging 0.98
R5384:Vmn2r118 UTSW 17 55611565 missense probably benign 0.00
R5385:Vmn2r118 UTSW 17 55611565 missense probably benign 0.00
R5664:Vmn2r118 UTSW 17 55592765 missense possibly damaging 0.46
R5740:Vmn2r118 UTSW 17 55593103 missense probably benign 0.00
R5927:Vmn2r118 UTSW 17 55624494 missense probably benign 0.04
R6143:Vmn2r118 UTSW 17 55592871 missense possibly damaging 0.92
R6513:Vmn2r118 UTSW 17 55608093 missense probably damaging 1.00
R6573:Vmn2r118 UTSW 17 55592996 missense probably damaging 1.00
R6760:Vmn2r118 UTSW 17 55592714 missense possibly damaging 0.92
R6794:Vmn2r118 UTSW 17 55592348 missense possibly damaging 0.48
R6929:Vmn2r118 UTSW 17 55610440 missense probably benign 0.01
R7201:Vmn2r118 UTSW 17 55608496 nonsense probably null
R7539:Vmn2r118 UTSW 17 55592853 missense probably damaging 0.98
R7836:Vmn2r118 UTSW 17 55593242 missense probably damaging 0.99
R8179:Vmn2r118 UTSW 17 55608484 missense probably benign 0.36
R8248:Vmn2r118 UTSW 17 55610936 missense probably benign 0.18
R8347:Vmn2r118 UTSW 17 55610423 missense possibly damaging 0.94
R8415:Vmn2r118 UTSW 17 55608057 missense probably benign 0.08
X0022:Vmn2r118 UTSW 17 55593218 missense probably damaging 1.00
Z1176:Vmn2r118 UTSW 17 55610655 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGGCCCATTGGATCATGTC -3'
(R):5'- CTGACTCAGTGCAATACCCATC -3'

Sequencing Primer
(F):5'- CAAGCCCTTGTGGAAAATT -3'
(R):5'- CAGCATGTAAAAGAAGGCTAATTTG -3'
Posted On2020-10-20