Mutagenetix > Incidental Mutation

Incidental Mutation 'R8428:Vmn2r118'

653626

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r118

Ensembl Gene

ENSMUSG00000091504

Gene Name

vomeronasal 2, receptor 118

Synonyms

EG383258, Vmn2r119, EG668547

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.141) question?

Stock #

R8428 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

55592341-55624672 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 55608642 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 436 (I436T)

Ref Sequence

ENSEMBL: ENSMUSP00000131128 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168440]

AlphaFold

E9Q1C1

Predicted Effect

probably benign
Transcript: ENSMUST00000168440
AA Change: I436T

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000131128
Gene: ENSMUSG00000091504
AA Change: I436T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	142	470	4.6e-27	PFAM
Pfam:NCD3G	513	566	2.6e-20	PFAM
Pfam:7tm_3	599	834	5.9e-55	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agap2	A	G	10: 127,087,306	I670V	unknown	Het
Bcan	G	T	3: 87,997,098	T117K	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Cbx8	C	A	11: 119,038,928	V280F	probably damaging	Het
Ccdc117	A	T	11: 5,534,350	S163R	possibly damaging	Het
Ccdc17	A	T	4: 116,599,626	I509F	probably damaging	Het
Cdon	T	C	9: 35,491,867	V1091A	probably benign	Het
Cntnap5b	C	T	1: 100,383,585	T972I	probably damaging	Het
Dlg2	T	C	7: 91,091,032	L9P	possibly damaging	Het
Dnah6	T	A	6: 73,074,651	R3053S	probably benign	Het
Dnah7a	T	A	1: 53,472,953	N2983I	probably damaging	Het
Dnah7c	T	C	1: 46,672,376	Y2588H	probably damaging	Het
Dpysl5	A	G	5: 30,745,467	D81G	probably damaging	Het
Dscaml1	A	G	9: 45,742,586	D1387G	probably benign	Het
Exd1	G	T	2: 119,538,867	T89K	possibly damaging	Het
Ezh2	T	A	6: 47,545,811	R364*	probably null	Het
Fam161b	C	T	12: 84,357,595	D104N	probably benign	Het
Fbxw8	C	A	5: 118,077,698	V416L	probably benign	Het
Flnc	A	T	6: 29,450,850	D1499V	probably benign	Het
Fmc1	A	T	6: 38,539,180	R54*	probably null	Het
Fzr1	A	G	10: 81,371,108	F61S	probably damaging	Het
Get4	T	G	5: 139,265,638	C160G	probably benign	Het
Gm14548	G	A	7: 3,895,258	T355I	probably benign	Het
Gm32742	G	A	9: 51,144,375	R1330*	probably null	Het
Gnat3	G	A	5: 18,015,314	A225T	possibly damaging	Het
Gucy2c	A	G	6: 136,727,894	Y541H	probably damaging	Het
Hand2	A	G	8: 57,322,426	T174A	probably benign	Het
Helb	T	C	10: 120,091,617	T863A	probably damaging	Het
Hoxa7	A	T	6: 52,218,013	V2D	unknown	Het
Ifi44	G	A	3: 151,739,341	R325*	probably null	Het
Igfn1	C	T	1: 135,967,782	G1682E	probably damaging	Het
Itch	A	G	2: 155,168,707	N32D	probably benign	Het
Kif26b	T	C	1: 178,917,358	V1673A	probably benign	Het
Map1a	A	T	2: 121,304,937	D2078V	probably benign	Het
Mgat4b	G	T	11: 50,230,685	V35L	probably benign	Het
Micu3	G	A	8: 40,308,164	M38I	probably benign	Het
Myo15	A	T	11: 60,496,415	H706L	probably damaging	Het
Ndc1	A	G	4: 107,368,820	T42A	probably benign	Het
Nfat5	T	A	8: 107,368,520	M1131K	probably damaging	Het
Nop14	G	A	5: 34,641,440	S648L	probably damaging	Het
Olfr639	G	T	7: 104,012,425	Y92*	probably null	Het
Otogl	A	G	10: 107,798,736	V1413A	probably damaging	Het
Palb2	T	A	7: 122,112,001	M967L	possibly damaging	Het
Ppa2	A	G	3: 133,348,143	K198R	probably damaging	Het
Prokr1	T	C	6: 87,588,774	T30A	probably benign	Het
Prss50	C	T	9: 110,858,060	R24C	unknown	Het
Rbm17	T	C	2: 11,600,630	T38A	possibly damaging	Het
Rps6ka5	G	A	12: 100,575,241	Q420*	probably null	Het
Senp6	G	T	9: 80,118,512	R448L	probably damaging	Het
Senp7	T	C	16: 56,179,028	I838T	probably damaging	Het
Sf3b2	C	T	19: 5,287,214	S329N	possibly damaging	Het
Slc13a4	A	T	6: 35,268,879	D610E	probably benign	Het
Slc24a2	A	G	4: 87,227,100	L239P	probably damaging	Het
Slc39a5	T	A	10: 128,397,015	H389L	probably damaging	Het
Syt4	A	G	18: 31,444,019	L94P	probably damaging	Het
Tgm5	A	G	2: 121,048,875	V560A	probably benign	Het
Thoc5	A	G	11: 4,926,115	T623A	probably damaging	Het
Tm7sf2	C	T	19: 6,063,044	V376I	probably benign	Het
Tmem268	T	A	4: 63,577,904	V194E	probably damaging	Het
Tpr	C	A	1: 150,414,813	R798S	probably damaging	Het
Trpv5	G	T	6: 41,653,248	T685K	possibly damaging	Het
Ttn	A	T	2: 76,754,430	N22141K	probably damaging	Het
Txnrd2	T	C	16: 18,456,298	I353T	unknown	Het
Upk1a	A	G	7: 30,603,618	Y252H	probably damaging	Het
Vmn2r76	T	A	7: 86,225,271	I833F	possibly damaging	Het
Zfp277	T	C	12: 40,329,578	H319R	probably damaging	Het

Other mutations in Vmn2r118

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Vmn2r118	APN	17	55592708	missense	probably damaging	1.00
IGL00976:Vmn2r118	APN	17	55593204	missense	probably damaging	1.00
IGL01419:Vmn2r118	APN	17	55593000	missense	probably benign	0.01
IGL01796:Vmn2r118	APN	17	55608585	missense	probably benign	0.30
IGL01799:Vmn2r118	APN	17	55592990	missense	probably damaging	1.00
IGL02002:Vmn2r118	APN	17	55592619	missense	probably damaging	1.00
IGL02075:Vmn2r118	APN	17	55610517	missense	probably benign	0.18
IGL02172:Vmn2r118	APN	17	55624598	missense	probably benign	0.00
IGL02529:Vmn2r118	APN	17	55610870	missense	possibly damaging	0.58
IGL02712:Vmn2r118	APN	17	55592655	missense	probably benign	0.21
IGL03096:Vmn2r118	APN	17	55607996	missense	probably damaging	1.00
R0306:Vmn2r118	UTSW	17	55608616	missense	possibly damaging	0.89
R0329:Vmn2r118	UTSW	17	55610717	missense	probably damaging	1.00
R0330:Vmn2r118	UTSW	17	55610717	missense	probably damaging	1.00
R0396:Vmn2r118	UTSW	17	55608643	missense	probably benign	0.00
R0411:Vmn2r118	UTSW	17	55611021	splice site	probably benign
R0513:Vmn2r118	UTSW	17	55610970	nonsense	probably null
R0627:Vmn2r118	UTSW	17	55610772	missense	probably benign	0.01
R0638:Vmn2r118	UTSW	17	55608466	missense	probably benign	0.03
R1328:Vmn2r118	UTSW	17	55608620	missense	probably benign	0.01
R1366:Vmn2r118	UTSW	17	55593237	nonsense	probably null
R1465:Vmn2r118	UTSW	17	55610935	missense	probably benign	0.33
R1465:Vmn2r118	UTSW	17	55610935	missense	probably benign	0.33
R1511:Vmn2r118	UTSW	17	55608496	nonsense	probably null
R1515:Vmn2r118	UTSW	17	55610643	missense	probably benign	0.25
R1550:Vmn2r118	UTSW	17	55608083	missense	probably damaging	1.00
R1779:Vmn2r118	UTSW	17	55611530	missense	probably benign	0.03
R1834:Vmn2r118	UTSW	17	55592456	missense	probably damaging	1.00
R1840:Vmn2r118	UTSW	17	55610406	nonsense	probably null
R1854:Vmn2r118	UTSW	17	55611556	missense	possibly damaging	0.57
R1967:Vmn2r118	UTSW	17	55592882	missense	probably damaging	1.00
R1976:Vmn2r118	UTSW	17	55592925	missense	probably damaging	1.00
R2308:Vmn2r118	UTSW	17	55624650	missense	probably benign	0.33
R3700:Vmn2r118	UTSW	17	55608421	missense	possibly damaging	0.68
R4334:Vmn2r118	UTSW	17	55610347	missense	possibly damaging	0.58
R4647:Vmn2r118	UTSW	17	55610665	missense	probably damaging	1.00
R4709:Vmn2r118	UTSW	17	55610860	missense	probably damaging	1.00
R4805:Vmn2r118	UTSW	17	55592581	missense	probably damaging	1.00
R4858:Vmn2r118	UTSW	17	55592894	missense	probably damaging	0.98
R5384:Vmn2r118	UTSW	17	55611565	missense	probably benign	0.00
R5385:Vmn2r118	UTSW	17	55611565	missense	probably benign	0.00
R5664:Vmn2r118	UTSW	17	55592765	missense	possibly damaging	0.46
R5740:Vmn2r118	UTSW	17	55593103	missense	probably benign	0.00
R5927:Vmn2r118	UTSW	17	55624494	missense	probably benign	0.04
R6143:Vmn2r118	UTSW	17	55592871	missense	possibly damaging	0.92
R6513:Vmn2r118	UTSW	17	55608093	missense	probably damaging	1.00
R6573:Vmn2r118	UTSW	17	55592996	missense	probably damaging	1.00
R6760:Vmn2r118	UTSW	17	55592714	missense	possibly damaging	0.92
R6794:Vmn2r118	UTSW	17	55592348	missense	possibly damaging	0.48
R6929:Vmn2r118	UTSW	17	55610440	missense	probably benign	0.01
R7201:Vmn2r118	UTSW	17	55608496	nonsense	probably null
R7539:Vmn2r118	UTSW	17	55592853	missense	probably damaging	0.98
R7836:Vmn2r118	UTSW	17	55593242	missense	probably damaging	0.99
R8179:Vmn2r118	UTSW	17	55608484	missense	probably benign	0.36
R8248:Vmn2r118	UTSW	17	55610936	missense	probably benign	0.18
R8347:Vmn2r118	UTSW	17	55610423	missense	possibly damaging	0.94
R8415:Vmn2r118	UTSW	17	55608057	missense	probably benign	0.08
R8917:Vmn2r118	UTSW	17	55610216	missense	possibly damaging	0.82
R8993:Vmn2r118	UTSW	17	55610835	missense	possibly damaging	0.72
R9038:Vmn2r118	UTSW	17	55611649	missense	probably damaging	1.00
R9155:Vmn2r118	UTSW	17	55610207	missense	probably null	0.83
R9603:Vmn2r118	UTSW	17	55592837	missense	probably damaging	1.00
R9742:Vmn2r118	UTSW	17	55611009	missense	probably damaging	0.98
R9749:Vmn2r118	UTSW	17	55608415	critical splice donor site	probably null
R9792:Vmn2r118	UTSW	17	55592496	missense	probably damaging	0.99
R9793:Vmn2r118	UTSW	17	55592496	missense	probably damaging	0.99
R9795:Vmn2r118	UTSW	17	55592496	missense	probably damaging	0.99
X0022:Vmn2r118	UTSW	17	55593218	missense	probably damaging	1.00
Z1176:Vmn2r118	UTSW	17	55610655	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGAGGCCCATTGGATCATGTC -3'
(R):5'- CTGACTCAGTGCAATACCCATC -3'

Sequencing Primer
(F):5'- CAAGCCCTTGTGGAAAATT -3'
(R):5'- CAGCATGTAAAAGAAGGCTAATTTG -3'

Posted On

2020-10-20