Incidental Mutation 'R8429:Epha4'
ID 653630
Institutional Source Beutler Lab
Gene Symbol Epha4
Ensembl Gene ENSMUSG00000026235
Gene Name Eph receptor A4
Synonyms Tyro1, Sek1, rb, Sek, Cek8, 2900005C20Rik, Hek8
MMRRC Submission 067774-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R8429 (G1)
Quality Score 130.008
Status Not validated
Chromosome 1
Chromosomal Location 77343822-77491725 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 77366673 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 591 (Q591K)
Ref Sequence ENSEMBL: ENSMUSP00000027451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027451] [ENSMUST00000188797] [ENSMUST00000188952] [ENSMUST00000190149]
AlphaFold Q03137
Predicted Effect probably benign
Transcript: ENSMUST00000027451
AA Change: Q591K

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000027451
Gene: ENSMUSG00000026235
AA Change: Q591K

DomainStartEndE-ValueType
EPH_lbd 30 204 1.35e-128 SMART
FN3 329 420 1.94e-8 SMART
FN3 441 522 9.18e-10 SMART
Pfam:EphA2_TM 548 618 1.7e-24 PFAM
TyrKc 621 878 1.91e-134 SMART
SAM 908 975 1.96e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188797
AA Change: Q591K

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000140954
Gene: ENSMUSG00000026235
AA Change: Q591K

DomainStartEndE-ValueType
EPH_lbd 30 204 1.35e-128 SMART
FN3 329 420 1.94e-8 SMART
FN3 441 522 9.18e-10 SMART
Pfam:EphA2_TM 547 618 1.8e-27 PFAM
TyrKc 621 878 1.91e-134 SMART
SAM 908 975 1.96e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188952
AA Change: Q591K

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000139640
Gene: ENSMUSG00000026235
AA Change: Q591K

DomainStartEndE-ValueType
EPH_lbd 30 204 1.35e-128 SMART
FN3 329 420 1.94e-8 SMART
FN3 441 522 9.18e-10 SMART
Pfam:EphA2_TM 547 618 1.8e-27 PFAM
TyrKc 621 878 1.91e-134 SMART
SAM 908 975 1.96e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190149
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mutants are known for their "hopping gait". Homozygotes for targeted null mutations show loss of limb alternation in locomotion and axon guidance defects of the corticospinal tract within medulla and spinal cord, resulting in aberrant midline projections. Heterozygotes show less severe phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(66) : Targeted, knock-out(3) Targeted, other(9) Gene trapped(52) Spontaneous(2)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A T 17: 48,347,875 (GRCm39) L143* probably null Het
2900026A02Rik T C 5: 113,331,302 (GRCm39) T971A probably benign Het
Abca6 A T 11: 110,093,208 (GRCm39) C1022S probably benign Het
Adgrf4 G T 17: 42,978,340 (GRCm39) N334K probably benign Het
Baz1b A G 5: 135,246,185 (GRCm39) K545E probably benign Het
Bin3 A G 14: 70,374,598 (GRCm39) Y209C probably damaging Het
Btbd16 G A 7: 130,397,067 (GRCm39) A223T probably benign Het
C3 A G 17: 57,529,811 (GRCm39) V555A probably damaging Het
Calm3 T A 7: 16,653,592 (GRCm39) probably null Het
Cct4 T A 11: 22,946,030 (GRCm39) L124Q probably damaging Het
Cenpf C T 1: 189,389,504 (GRCm39) D1443N possibly damaging Het
Egfem1 G A 3: 29,711,417 (GRCm39) probably null Het
Fanci T C 7: 79,088,133 (GRCm39) F929L possibly damaging Het
Fnip1 A T 11: 54,366,522 (GRCm39) D95V possibly damaging Het
Foxc1 A T 13: 31,991,759 (GRCm39) H190L probably benign Het
Gm45713 T C 7: 44,785,540 (GRCm39) S2G unknown Het
Grin2b T C 6: 135,710,914 (GRCm39) I877M probably damaging Het
Hadha T C 5: 30,349,255 (GRCm39) I119V probably benign Het
Hcar2 C T 5: 124,003,538 (GRCm39) probably benign Het
Irag2 C A 6: 145,110,949 (GRCm39) D251E probably damaging Het
Krt13 A T 11: 100,011,951 (GRCm39) L124Q probably damaging Het
Larp1b A G 3: 40,931,662 (GRCm39) *336W probably null Het
Man2c1 T C 9: 57,038,445 (GRCm39) L35P probably damaging Het
Meioc A T 11: 102,565,032 (GRCm39) N160I probably benign Het
Mfsd2b G T 12: 4,916,487 (GRCm39) Q331K possibly damaging Het
Mical2 T A 7: 111,944,460 (GRCm39) V930E probably benign Het
Mrgprb4 A T 7: 47,848,173 (GRCm39) F252I probably benign Het
Nars1 A G 18: 64,634,391 (GRCm39) Y511H probably damaging Het
Naxe C A 3: 87,965,459 (GRCm39) S84I probably damaging Het
Ncam2 A T 16: 81,386,523 (GRCm39) D634V probably damaging Het
Npat C T 9: 53,481,909 (GRCm39) Q1206* probably null Het
Nr1d2 G A 14: 18,215,409 (GRCm38) T201I probably benign Het
Nt5el A G 13: 105,255,296 (GRCm39) Y459C probably damaging Het
Nup155 C T 15: 8,141,904 (GRCm39) H99Y probably damaging Het
Or10ag60 G T 2: 87,437,868 (GRCm39) L45F probably benign Het
Or4f4b G A 2: 111,313,840 (GRCm39) V50I possibly damaging Het
Or5ac25 A G 16: 59,181,990 (GRCm39) V197A possibly damaging Het
Or9k2b A G 10: 130,016,092 (GRCm39) V219A possibly damaging Het
Pcnx3 C T 19: 5,715,412 (GRCm39) G1946E probably damaging Het
Pde6a T A 18: 61,365,916 (GRCm39) Y214N probably damaging Het
Pex7 T C 10: 19,770,074 (GRCm39) T145A probably damaging Het
Plekhj1 C T 10: 80,632,304 (GRCm39) S146N probably benign Het
Ralgapb C T 2: 158,268,217 (GRCm39) P107S probably damaging Het
Satb1 A G 17: 52,074,978 (GRCm39) M506T probably damaging Het
Sh3gl1 T C 17: 56,325,821 (GRCm39) N203D possibly damaging Het
Slc7a12 A T 3: 14,562,342 (GRCm39) I240F probably benign Het
Spata31h1 G T 10: 82,125,301 (GRCm39) Q2570K possibly damaging Het
Syt17 T A 7: 118,033,564 (GRCm39) Y144F probably benign Het
Thbd G T 2: 148,249,457 (GRCm39) T137K possibly damaging Het
Tmem114 A G 16: 8,230,031 (GRCm39) F124L probably damaging Het
Ubtd1 G T 19: 42,020,556 (GRCm39) probably null Het
Zfp458 A G 13: 67,406,152 (GRCm39) Y96H possibly damaging Het
Zfp78 T C 7: 6,381,492 (GRCm39) S181P probably benign Het
Other mutations in Epha4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Epha4 APN 1 77,375,194 (GRCm39) missense probably benign 0.00
IGL01350:Epha4 APN 1 77,483,492 (GRCm39) missense probably damaging 1.00
IGL01657:Epha4 APN 1 77,403,475 (GRCm39) missense probably damaging 1.00
IGL01872:Epha4 APN 1 77,359,676 (GRCm39) missense probably benign 0.03
IGL02366:Epha4 APN 1 77,403,348 (GRCm39) nonsense probably null
IGL02426:Epha4 APN 1 77,421,514 (GRCm39) missense probably benign 0.01
IGL02428:Epha4 APN 1 77,483,385 (GRCm39) missense possibly damaging 0.94
IGL02706:Epha4 APN 1 77,403,482 (GRCm39) missense probably damaging 1.00
IGL02716:Epha4 APN 1 77,357,602 (GRCm39) missense probably damaging 1.00
IGL03348:Epha4 APN 1 77,483,809 (GRCm39) missense possibly damaging 0.82
frog UTSW 1 77,481,076 (GRCm38) intron probably benign
R0324:Epha4 UTSW 1 77,360,188 (GRCm39) missense probably damaging 1.00
R0392:Epha4 UTSW 1 77,483,610 (GRCm39) missense probably benign 0.00
R0538:Epha4 UTSW 1 77,365,178 (GRCm39) missense probably damaging 1.00
R0562:Epha4 UTSW 1 77,365,124 (GRCm39) missense probably benign 0.00
R0885:Epha4 UTSW 1 77,359,576 (GRCm39) missense probably damaging 0.99
R1509:Epha4 UTSW 1 77,357,523 (GRCm39) missense probably damaging 1.00
R1620:Epha4 UTSW 1 77,351,563 (GRCm39) missense probably benign 0.31
R1624:Epha4 UTSW 1 77,376,329 (GRCm39) missense probably damaging 1.00
R1654:Epha4 UTSW 1 77,351,405 (GRCm39) splice site probably null
R1755:Epha4 UTSW 1 77,364,460 (GRCm39) missense probably damaging 1.00
R1807:Epha4 UTSW 1 77,351,541 (GRCm39) missense probably benign 0.05
R2046:Epha4 UTSW 1 77,483,799 (GRCm39) missense probably damaging 1.00
R2504:Epha4 UTSW 1 77,359,628 (GRCm39) missense probably damaging 1.00
R2509:Epha4 UTSW 1 77,488,339 (GRCm39) missense possibly damaging 0.84
R2511:Epha4 UTSW 1 77,488,339 (GRCm39) missense possibly damaging 0.84
R3441:Epha4 UTSW 1 77,403,333 (GRCm39) missense possibly damaging 0.90
R3724:Epha4 UTSW 1 77,403,180 (GRCm39) splice site probably benign
R3901:Epha4 UTSW 1 77,357,539 (GRCm39) missense probably damaging 1.00
R3950:Epha4 UTSW 1 77,376,353 (GRCm39) missense probably damaging 1.00
R3951:Epha4 UTSW 1 77,376,353 (GRCm39) missense probably damaging 1.00
R3952:Epha4 UTSW 1 77,376,353 (GRCm39) missense probably damaging 1.00
R4012:Epha4 UTSW 1 77,366,731 (GRCm39) splice site probably benign
R4321:Epha4 UTSW 1 77,483,850 (GRCm39) critical splice acceptor site probably null
R4422:Epha4 UTSW 1 77,488,354 (GRCm39) missense probably damaging 0.99
R4898:Epha4 UTSW 1 77,366,712 (GRCm39) nonsense probably null
R5072:Epha4 UTSW 1 77,421,639 (GRCm39) missense probably damaging 1.00
R5270:Epha4 UTSW 1 77,483,244 (GRCm39) missense probably damaging 1.00
R5281:Epha4 UTSW 1 77,351,504 (GRCm39) missense probably benign
R5315:Epha4 UTSW 1 77,365,109 (GRCm39) critical splice donor site probably null
R5531:Epha4 UTSW 1 77,351,513 (GRCm39) missense probably benign
R5621:Epha4 UTSW 1 77,491,686 (GRCm39) utr 5 prime probably benign
R5648:Epha4 UTSW 1 77,375,162 (GRCm39) missense probably benign 0.25
R5747:Epha4 UTSW 1 77,483,520 (GRCm39) missense probably damaging 0.99
R5829:Epha4 UTSW 1 77,421,631 (GRCm39) missense probably benign 0.01
R6185:Epha4 UTSW 1 77,483,743 (GRCm39) missense probably damaging 1.00
R6486:Epha4 UTSW 1 77,360,186 (GRCm39) missense probably damaging 1.00
R6821:Epha4 UTSW 1 77,359,582 (GRCm39) missense possibly damaging 0.88
R6978:Epha4 UTSW 1 77,354,220 (GRCm39) missense probably damaging 1.00
R7039:Epha4 UTSW 1 77,483,422 (GRCm39) missense probably damaging 1.00
R7216:Epha4 UTSW 1 77,421,621 (GRCm39) missense probably damaging 1.00
R7270:Epha4 UTSW 1 77,376,422 (GRCm39) missense probably damaging 1.00
R7444:Epha4 UTSW 1 77,364,553 (GRCm39) missense probably damaging 1.00
R7737:Epha4 UTSW 1 77,357,649 (GRCm39) missense probably damaging 1.00
R7763:Epha4 UTSW 1 77,366,668 (GRCm39) critical splice donor site probably null
R7950:Epha4 UTSW 1 77,483,833 (GRCm39) missense probably damaging 0.99
R8297:Epha4 UTSW 1 77,483,547 (GRCm39) missense probably damaging 1.00
R8373:Epha4 UTSW 1 77,483,716 (GRCm39) missense possibly damaging 0.60
R8907:Epha4 UTSW 1 77,483,422 (GRCm39) missense probably damaging 1.00
R9024:Epha4 UTSW 1 77,365,169 (GRCm39) missense possibly damaging 0.79
Z1088:Epha4 UTSW 1 77,483,299 (GRCm39) missense possibly damaging 0.61
Z1176:Epha4 UTSW 1 77,359,648 (GRCm39) missense probably damaging 1.00
Z1176:Epha4 UTSW 1 77,350,370 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- CCTTGACAGCCTTGACGAATG -3'
(R):5'- GATGGCTTCAGCTCTTCACC -3'

Sequencing Primer
(F):5'- ACAGCCTTGACGAATGTTATTTGG -3'
(R):5'- AAGCCTCAGTTTCCCTATGTGTAAC -3'
Posted On 2020-10-20