Mutagenetix > Incidental Mutation

Incidental Mutation 'R8429:Cenpf'

653631

Institutional Source

Beutler Lab

Gene Symbol

Cenpf

Ensembl Gene

ENSMUSG00000026605

Gene Name

centromere protein F

Synonyms

mitosin, 6530404A22Rik, Lek1

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.378) question?

Stock #

R8429 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

189640606-189688086 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 189657307 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 1443 (D1443N)

Ref Sequence

ENSEMBL: ENSMUSP00000129738 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165962] [ENSMUST00000171929]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000165962

SMART Domains

Protein: ENSMUSP00000132759
Gene: ENSMUSG00000026605

Domain	Start	End	E-Value	Type
Pfam:CENP-F_N	1	300	7.3e-135	PFAM
low complexity region	332	347	N/A	INTRINSIC
low complexity region	361	379	N/A	INTRINSIC
low complexity region	527	540	N/A	INTRINSIC
low complexity region	572	592	N/A	INTRINSIC
internal_repeat_1	737	759	3.18e-5	PROSPERO
internal_repeat_1	751	773	3.18e-5	PROSPERO
internal_repeat_2	789	804	5.94e-5	PROSPERO
coiled coil region	812	864	N/A	INTRINSIC
coiled coil region	885	923	N/A	INTRINSIC
low complexity region	925	936	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171929
AA Change: D1443N

PolyPhen 2 Score 0.720 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000129738
Gene: ENSMUSG00000026605
AA Change: D1443N

Domain	Start	End	E-Value	Type
Pfam:CENP-F_N	1	300	2.8e-144	PFAM
low complexity region	349	364	N/A	INTRINSIC
low complexity region	378	396	N/A	INTRINSIC
low complexity region	544	557	N/A	INTRINSIC
low complexity region	589	609	N/A	INTRINSIC
internal_repeat_5	678	707	8.32e-5	PROSPERO
internal_repeat_3	743	798	2.21e-5	PROSPERO
internal_repeat_1	780	812	2.12e-7	PROSPERO
coiled coil region	829	881	N/A	INTRINSIC
coiled coil region	902	1169	N/A	INTRINSIC
coiled coil region	1206	1364	N/A	INTRINSIC
internal_repeat_2	1381	1413	3.02e-6	PROSPERO
internal_repeat_3	1412	1470	2.21e-5	PROSPERO
low complexity region	1526	1542	N/A	INTRINSIC
coiled coil region	1560	1650	N/A	INTRINSIC
internal_repeat_2	1655	1687	3.02e-6	PROSPERO
low complexity region	1744	1755	N/A	INTRINSIC
coiled coil region	1822	1852	N/A	INTRINSIC
Pfam:CENP-F_leu_zip	1893	2035	1.2e-14	PFAM
Pfam:CENP-F_leu_zip	2131	2270	1.5e-47	PFAM
Pfam:CENP-F_leu_zip	2313	2449	1e-46	PFAM
low complexity region	2544	2555	N/A	INTRINSIC
low complexity region	2642	2654	N/A	INTRINSIC
low complexity region	2755	2769	N/A	INTRINSIC
internal_repeat_4	2778	2801	4.28e-5	PROSPERO
low complexity region	2837	2847	N/A	INTRINSIC
Pfam:CENP-F_C_Rb_bdg	2850	2896	6.6e-29	PFAM
internal_repeat_1	2935	2964	2.12e-7	PROSPERO
internal_repeat_4	2946	2969	4.28e-5	PROSPERO

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that associates with the centromere-kinetochore complex. The protein is a component of the nuclear matrix during the G2 phase of interphase. In late G2 the protein associates with the kinetochore and maintains this association through early anaphase. It localizes to the spindle midzone and the intracellular bridge in late anaphase and telophase, respectively, and is thought to be subsequently degraded. The localization of this protein suggests that it may play a role in chromosome segregation during mitotis. It is thought to form either a homodimer or heterodimer. Autoantibodies against this protein have been found in patients with cancer or graft versus host disease. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700122O11Rik	A	T	17: 48,037,066	L143*	probably null	Het
2900026A02Rik	T	C	5: 113,183,436	T971A	probably benign	Het
4932415D10Rik	G	T	10: 82,289,467	Q2570K	possibly damaging	Het
4933425L06Rik	A	G	13: 105,118,788	Y459C	probably damaging	Het
Abca6	A	T	11: 110,202,382	C1022S	probably benign	Het
Adgrf4	G	T	17: 42,667,449	N334K	probably benign	Het
Baz1b	A	G	5: 135,217,331	K545E	probably benign	Het
Bin3	A	G	14: 70,137,149	Y209C	probably damaging	Het
Btbd16	G	A	7: 130,795,337	A223T	probably benign	Het
C3	A	G	17: 57,222,811	V555A	probably damaging	Het
Calm3	T	A	7: 16,919,667		probably null	Het
Cct4	T	A	11: 22,996,030	L124Q	probably damaging	Het
Egfem1	G	A	3: 29,657,268		probably null	Het
Epha4	G	T	1: 77,390,036	Q591K	probably benign	Het
Fanci	T	C	7: 79,438,385	F929L	possibly damaging	Het
Fnip1	A	T	11: 54,475,696	D95V	possibly damaging	Het
Foxc1	A	T	13: 31,807,776	H190L	probably benign	Het
Gm45713	T	C	7: 45,136,116	S2G	unknown	Het
Grin2b	T	C	6: 135,733,916	I877M	probably damaging	Het
Hadha	T	C	5: 30,144,257	I119V	probably benign	Het
Hcar2	C	T	5: 123,865,475		probably benign	Het
Krt13	A	T	11: 100,121,125	L124Q	probably damaging	Het
Larp1b	A	G	3: 40,977,227	*336W	probably null	Het
Lrmp	C	A	6: 145,165,223	D251E	probably damaging	Het
Man2c1	T	C	9: 57,131,161	L35P	probably damaging	Het
Meioc	A	T	11: 102,674,206	N160I	probably benign	Het
Mfsd2b	G	T	12: 4,866,487	Q331K	possibly damaging	Het
Mical2	T	A	7: 112,345,253	V930E	probably benign	Het
Mrgprb4	A	T	7: 48,198,425	F252I	probably benign	Het
Nars	A	G	18: 64,501,320	Y511H	probably damaging	Het
Naxe	C	A	3: 88,058,152	S84I	probably damaging	Het
Ncam2	A	T	16: 81,589,635	D634V	probably damaging	Het
Npat	C	T	9: 53,570,609	Q1206*	probably null	Het
Nr1d2	G	A	14: 18,215,409	T201I	probably benign	Het
Nup155	C	T	15: 8,112,420	H99Y	probably damaging	Het
Olfr1130	G	T	2: 87,607,524	L45F	probably benign	Het
Olfr1289	G	A	2: 111,483,495	V50I	possibly damaging	Het
Olfr209	A	G	16: 59,361,627	V197A	possibly damaging	Het
Olfr826	A	G	10: 130,180,223	V219A	possibly damaging	Het
Pcnx3	C	T	19: 5,665,384	G1946E	probably damaging	Het
Pde6a	T	A	18: 61,232,844	Y214N	probably damaging	Het
Pex7	T	C	10: 19,894,328	T145A	probably damaging	Het
Plekhj1	C	T	10: 80,796,470	S146N	probably benign	Het
Ralgapb	C	T	2: 158,426,297	P107S	probably damaging	Het
Satb1	A	G	17: 51,767,950	M506T	probably damaging	Het
Sh3gl1	T	C	17: 56,018,821	N203D	possibly damaging	Het
Slc7a12	A	T	3: 14,497,282	I240F	probably benign	Het
Syt17	T	A	7: 118,434,341	Y144F	probably benign	Het
Thbd	G	T	2: 148,407,537	T137K	possibly damaging	Het
Tmem114	A	G	16: 8,412,167	F124L	probably damaging	Het
Ubtd1	G	T	19: 42,032,117		probably null	Het
Zfp458	A	G	13: 67,258,088	Y96H	possibly damaging	Het
Zfp78	T	C	7: 6,378,493	S181P	probably benign	Het

Other mutations in Cenpf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00778:Cenpf	APN	1	189654912	missense	probably benign	0.01
IGL01154:Cenpf	APN	1	189680333	missense	probably benign	0.19
IGL01434:Cenpf	APN	1	189657868	nonsense	probably null
IGL01461:Cenpf	APN	1	189657096	missense	probably damaging	1.00
IGL01615:Cenpf	APN	1	189653184	missense	possibly damaging	0.68
IGL01720:Cenpf	APN	1	189682386	missense	probably benign	0.05
IGL01720:Cenpf	APN	1	189651215	missense	probably damaging	0.99
IGL01803:Cenpf	APN	1	189654771	nonsense	probably null
IGL02152:Cenpf	APN	1	189649012	missense	probably benign
IGL02222:Cenpf	APN	1	189654444	missense	probably benign
IGL02338:Cenpf	APN	1	189680418	missense	probably damaging	1.00
IGL02580:Cenpf	APN	1	189657441	missense	probably benign	0.20
IGL02629:Cenpf	APN	1	189652334	missense	probably damaging	1.00
IGL02650:Cenpf	APN	1	189652473	missense	possibly damaging	0.91
IGL02660:Cenpf	APN	1	189654782	missense	probably damaging	1.00
IGL02703:Cenpf	APN	1	189659758	missense	probably benign	0.14
IGL02809:Cenpf	APN	1	189682358	splice site	probably benign
IGL02851:Cenpf	APN	1	189658030	missense	probably damaging	1.00
IGL02903:Cenpf	APN	1	189646876	missense	probably damaging	0.99
IGL03126:Cenpf	APN	1	189659010	missense	probably damaging	1.00
IGL03235:Cenpf	APN	1	189683927	missense	probably damaging	1.00
IGL03336:Cenpf	APN	1	189652647	missense	probably damaging	0.99
IGL03402:Cenpf	APN	1	189655076	missense	probably damaging	1.00
IGL02799:Cenpf	UTSW	1	189659652	missense	probably damaging	1.00
R0011:Cenpf	UTSW	1	189650706	missense	probably benign	0.05
R0129:Cenpf	UTSW	1	189659650	missense	probably benign	0.26
R0157:Cenpf	UTSW	1	189652359	missense	probably benign	0.07
R0270:Cenpf	UTSW	1	189650714	missense	probably benign	0.01
R0607:Cenpf	UTSW	1	189682463	splice site	probably null
R0621:Cenpf	UTSW	1	189672628	missense	probably benign
R0639:Cenpf	UTSW	1	189658062	missense	probably benign	0.01
R0653:Cenpf	UTSW	1	189659986	missense	probably damaging	1.00
R0718:Cenpf	UTSW	1	189653984	missense	probably damaging	1.00
R1157:Cenpf	UTSW	1	189658453	missense	probably benign	0.20
R1331:Cenpf	UTSW	1	189642801	missense	probably damaging	0.99
R1463:Cenpf	UTSW	1	189654739	missense	probably damaging	0.97
R1514:Cenpf	UTSW	1	189679141	missense	possibly damaging	0.67
R1529:Cenpf	UTSW	1	189660038	missense	probably benign	0.00
R1574:Cenpf	UTSW	1	189652713	missense	probably damaging	1.00
R1574:Cenpf	UTSW	1	189652713	missense	probably damaging	1.00
R1662:Cenpf	UTSW	1	189657771	missense	probably damaging	0.99
R1671:Cenpf	UTSW	1	189679144	splice site	probably null
R1725:Cenpf	UTSW	1	189680479	missense	probably damaging	0.99
R1743:Cenpf	UTSW	1	189654263	missense	probably benign	0.19
R1874:Cenpf	UTSW	1	189683816	missense	probably damaging	1.00
R1884:Cenpf	UTSW	1	189646849	missense	probably benign
R1980:Cenpf	UTSW	1	189653915	missense	probably benign	0.04
R2074:Cenpf	UTSW	1	189656901	missense	probably damaging	1.00
R2096:Cenpf	UTSW	1	189653459	missense	possibly damaging	0.95
R2109:Cenpf	UTSW	1	189679067	missense	probably damaging	0.99
R2113:Cenpf	UTSW	1	189679102	missense	probably damaging	0.96
R2134:Cenpf	UTSW	1	189658642	missense	probably benign	0.03
R2209:Cenpf	UTSW	1	189652598	missense	probably benign	0.04
R2875:Cenpf	UTSW	1	189658644	missense	probably benign	0.11
R2876:Cenpf	UTSW	1	189658644	missense	probably benign	0.11
R3433:Cenpf	UTSW	1	189659949	missense	probably damaging	0.99
R3709:Cenpf	UTSW	1	189648812	missense	possibly damaging	0.72
R3786:Cenpf	UTSW	1	189658337	missense	probably damaging	1.00
R4014:Cenpf	UTSW	1	189653159	missense	probably benign	0.01
R4108:Cenpf	UTSW	1	189683868	missense	probably damaging	1.00
R4119:Cenpf	UTSW	1	189653045	missense	probably benign	0.01
R4177:Cenpf	UTSW	1	189668619	missense	possibly damaging	0.95
R4422:Cenpf	UTSW	1	189658350	missense	probably damaging	1.00
R4546:Cenpf	UTSW	1	189654650	missense	probably damaging	1.00
R4592:Cenpf	UTSW	1	189679033	missense	probably damaging	1.00
R4643:Cenpf	UTSW	1	189659589	missense	probably benign	0.00
R4650:Cenpf	UTSW	1	189660038	missense	probably benign	0.00
R4801:Cenpf	UTSW	1	189651220	missense	probably damaging	1.00
R4802:Cenpf	UTSW	1	189651220	missense	probably damaging	1.00
R4817:Cenpf	UTSW	1	189682369	missense	possibly damaging	0.93
R4871:Cenpf	UTSW	1	189658531	missense	probably damaging	1.00
R5037:Cenpf	UTSW	1	189683846	missense	probably damaging	1.00
R5106:Cenpf	UTSW	1	189683808	missense	probably benign	0.00
R5208:Cenpf	UTSW	1	189671046	critical splice donor site	probably null
R5213:Cenpf	UTSW	1	189654980	missense	probably benign	0.04
R5237:Cenpf	UTSW	1	189659533	missense	probably benign	0.28
R5255:Cenpf	UTSW	1	189672627	missense	possibly damaging	0.49
R5378:Cenpf	UTSW	1	189653466	missense	possibly damaging	0.95
R5468:Cenpf	UTSW	1	189652371	missense	probably damaging	1.00
R5510:Cenpf	UTSW	1	189682903	missense	probably benign	0.14
R5616:Cenpf	UTSW	1	189657286	missense	probably damaging	1.00
R5652:Cenpf	UTSW	1	189657082	missense	probably damaging	0.99
R5735:Cenpf	UTSW	1	189654363	missense	probably benign	0.10
R5841:Cenpf	UTSW	1	189657444	missense	possibly damaging	0.90
R5943:Cenpf	UTSW	1	189659969	missense	possibly damaging	0.75
R6082:Cenpf	UTSW	1	189658104	missense	probably benign	0.11
R6108:Cenpf	UTSW	1	189662013	missense	probably benign	0.03
R6269:Cenpf	UTSW	1	189659920	missense	probably benign	0.37
R6284:Cenpf	UTSW	1	189652742	missense	probably damaging	1.00
R6425:Cenpf	UTSW	1	189659898	missense	probably benign	0.09
R6587:Cenpf	UTSW	1	189658374	missense	probably damaging	1.00
R6747:Cenpf	UTSW	1	189652854	missense	probably benign	0.15
R6811:Cenpf	UTSW	1	189654542	missense	probably benign	0.06
R6834:Cenpf	UTSW	1	189659446	missense	probably damaging	1.00
R6951:Cenpf	UTSW	1	189653792	missense	probably damaging	1.00
R7095:Cenpf	UTSW	1	189659176	missense	probably benign	0.01
R7128:Cenpf	UTSW	1	189684991	missense	probably damaging	1.00
R7185:Cenpf	UTSW	1	189653489	missense	probably damaging	1.00
R7292:Cenpf	UTSW	1	189650694	missense	probably damaging	1.00
R7353:Cenpf	UTSW	1	189654138	nonsense	probably null
R7402:Cenpf	UTSW	1	189659378	nonsense	probably null
R7460:Cenpf	UTSW	1	189654050	missense	probably damaging	0.97
R7484:Cenpf	UTSW	1	189656821	missense	probably damaging	1.00
R7574:Cenpf	UTSW	1	189658667	missense	probably damaging	1.00
R7691:Cenpf	UTSW	1	189658207	nonsense	probably null
R7698:Cenpf	UTSW	1	189662072	missense	probably benign	0.01
R7901:Cenpf	UTSW	1	189657248	missense	probably damaging	1.00
R7941:Cenpf	UTSW	1	189657286	missense	probably damaging	1.00
R8007:Cenpf	UTSW	1	189646947	missense
R8194:Cenpf	UTSW	1	189682403	missense	probably benign	0.06
R8420:Cenpf	UTSW	1	189672585	missense	probably damaging	1.00
R8477:Cenpf	UTSW	1	189653188	missense	probably benign
R8492:Cenpf	UTSW	1	189658729	missense	probably damaging	0.99
R8510:Cenpf	UTSW	1	189650706	missense	probably benign	0.01
R8686:Cenpf	UTSW	1	189659604	missense	probably benign	0.00
R8696:Cenpf	UTSW	1	189657997	missense	probably benign	0.20
R8855:Cenpf	UTSW	1	189653233	missense	probably benign	0.11
R8901:Cenpf	UTSW	1	189662051	missense	probably benign	0.30
R8958:Cenpf	UTSW	1	189653153	missense	possibly damaging	0.81
R9109:Cenpf	UTSW	1	189659374	missense	probably benign	0.06
R9135:Cenpf	UTSW	1	189672549	missense	probably damaging	1.00
R9136:Cenpf	UTSW	1	189671155	missense	probably benign	0.02
R9198:Cenpf	UTSW	1	189656790	missense	probably damaging	1.00
R9240:Cenpf	UTSW	1	189656970	missense	probably benign	0.01
R9303:Cenpf	UTSW	1	189660074	critical splice acceptor site	probably null
R9305:Cenpf	UTSW	1	189660074	critical splice acceptor site	probably null
R9354:Cenpf	UTSW	1	189646917	missense
R9502:Cenpf	UTSW	1	189656781	missense	probably damaging	1.00
R9619:Cenpf	UTSW	1	189653768	missense	probably benign	0.01
RF006:Cenpf	UTSW	1	189657386	missense	probably damaging	1.00
X0025:Cenpf	UTSW	1	189653874	missense	possibly damaging	0.79
X0066:Cenpf	UTSW	1	189657929	missense	probably benign	0.23
Z1088:Cenpf	UTSW	1	189652931	missense	probably damaging	1.00
Z1176:Cenpf	UTSW	1	189659472	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGAAGCGTTCCCTTCTAAAC -3'
(R):5'- TCCTTTGGACAGTAGCAATTTCTG -3'

Sequencing Primer
(F):5'- ACTTAGATGACATGTGTCTCCAG -3'
(R):5'- CTGTGAACAGATGACCTTGTCAAGC -3'

Posted On

2020-10-20