Incidental Mutation 'R8429:Olfr1289'
ID653633
Institutional Source Beutler Lab
Gene Symbol Olfr1289
Ensembl Gene ENSMUSG00000061195
Gene Nameolfactory receptor 1289
SynonymsGA_x6K02T2Q125-72534883-72535821, MOR245-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R8429 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location111480819-111484615 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 111483495 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 50 (V50I)
Ref Sequence ENSEMBL: ENSMUSP00000146801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104889] [ENSMUST00000120021] [ENSMUST00000207494] [ENSMUST00000214816] [ENSMUST00000217611]
Predicted Effect probably benign
Transcript: ENSMUST00000104889
SMART Domains Protein: ENSMUSP00000100485
Gene: ENSMUSG00000044039

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 1.3e-43 PFAM
Pfam:7tm_1 41 287 2.5e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120021
AA Change: V50I

PolyPhen 2 Score 0.547 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000207494
AA Change: V22I

PolyPhen 2 Score 0.602 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000214816
Predicted Effect probably benign
Transcript: ENSMUST00000217611
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A T 17: 48,037,066 L143* probably null Het
2900026A02Rik T C 5: 113,183,436 T971A probably benign Het
4932415D10Rik G T 10: 82,289,467 Q2570K possibly damaging Het
4933425L06Rik A G 13: 105,118,788 Y459C probably damaging Het
Abca6 A T 11: 110,202,382 C1022S probably benign Het
Adgrf4 G T 17: 42,667,449 N334K probably benign Het
Baz1b A G 5: 135,217,331 K545E probably benign Het
Bin3 A G 14: 70,137,149 Y209C probably damaging Het
Btbd16 G A 7: 130,795,337 A223T probably benign Het
C3 A G 17: 57,222,811 V555A probably damaging Het
Calm3 T A 7: 16,919,667 probably null Het
Cct4 T A 11: 22,996,030 L124Q probably damaging Het
Cenpf C T 1: 189,657,307 D1443N possibly damaging Het
Egfem1 G A 3: 29,657,268 probably null Het
Epha4 G T 1: 77,390,036 Q591K probably benign Het
Fanci T C 7: 79,438,385 F929L possibly damaging Het
Fnip1 A T 11: 54,475,696 D95V possibly damaging Het
Foxc1 A T 13: 31,807,776 H190L probably benign Het
Gm45713 T C 7: 45,136,116 S2G unknown Het
Grin2b T C 6: 135,733,916 I877M probably damaging Het
Hadha T C 5: 30,144,257 I119V probably benign Het
Hcar2 C T 5: 123,865,475 probably benign Het
Krt13 A T 11: 100,121,125 L124Q probably damaging Het
Larp1b A G 3: 40,977,227 *336W probably null Het
Lrmp C A 6: 145,165,223 D251E probably damaging Het
Man2c1 T C 9: 57,131,161 L35P probably damaging Het
Meioc A T 11: 102,674,206 N160I probably benign Het
Mfsd2b G T 12: 4,866,487 Q331K possibly damaging Het
Mical2 T A 7: 112,345,253 V930E probably benign Het
Mrgprb4 A T 7: 48,198,425 F252I probably benign Het
Nars A G 18: 64,501,320 Y511H probably damaging Het
Naxe C A 3: 88,058,152 S84I probably damaging Het
Ncam2 A T 16: 81,589,635 D634V probably damaging Het
Npat C T 9: 53,570,609 Q1206* probably null Het
Nr1d2 G A 14: 18,215,409 T201I probably benign Het
Nup155 C T 15: 8,112,420 H99Y probably damaging Het
Olfr1130 G T 2: 87,607,524 L45F probably benign Het
Olfr209 A G 16: 59,361,627 V197A possibly damaging Het
Olfr826 A G 10: 130,180,223 V219A possibly damaging Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Pde6a T A 18: 61,232,844 Y214N probably damaging Het
Pex7 T C 10: 19,894,328 T145A probably damaging Het
Plekhj1 C T 10: 80,796,470 S146N probably benign Het
Ralgapb C T 2: 158,426,297 P107S probably damaging Het
Satb1 A G 17: 51,767,950 M506T probably damaging Het
Sh3gl1 T C 17: 56,018,821 N203D possibly damaging Het
Slc7a12 A T 3: 14,497,282 I240F probably benign Het
Syt17 T A 7: 118,434,341 Y144F probably benign Het
Thbd G T 2: 148,407,537 T137K possibly damaging Het
Tmem114 A G 16: 8,412,167 F124L probably damaging Het
Ubtd1 G T 19: 42,032,117 probably null Het
Zfp458 A G 13: 67,258,088 Y96H possibly damaging Het
Zfp78 T C 7: 6,378,493 S181P probably benign Het
Other mutations in Olfr1289
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Olfr1289 APN 2 111484101 missense probably damaging 1.00
IGL01682:Olfr1289 APN 2 111483843 missense probably damaging 1.00
IGL02028:Olfr1289 APN 2 111483471 missense probably benign 0.01
IGL02731:Olfr1289 APN 2 111483528 missense probably benign 0.00
IGL03035:Olfr1289 APN 2 111483823 missense probably benign 0.04
R1214:Olfr1289 UTSW 2 111483892 missense probably damaging 1.00
R1471:Olfr1289 UTSW 2 111484006 missense probably damaging 1.00
R1714:Olfr1289 UTSW 2 111483663 missense probably damaging 1.00
R2088:Olfr1289 UTSW 2 111484278 missense probably damaging 1.00
R2136:Olfr1289 UTSW 2 111483616 missense probably damaging 1.00
R2141:Olfr1289 UTSW 2 111483630 missense probably benign 0.23
R3945:Olfr1289 UTSW 2 111483687 nonsense probably null
R4276:Olfr1289 UTSW 2 111483504 missense probably damaging 1.00
R4562:Olfr1289 UTSW 2 111483564 missense probably benign 0.00
R4896:Olfr1289 UTSW 2 111483660 missense possibly damaging 0.82
R4946:Olfr1289 UTSW 2 111483966 missense possibly damaging 0.93
R5004:Olfr1289 UTSW 2 111483660 missense possibly damaging 0.82
R5686:Olfr1289 UTSW 2 111484143 missense probably damaging 1.00
R6032:Olfr1289 UTSW 2 111483850 missense probably damaging 1.00
R6032:Olfr1289 UTSW 2 111483850 missense probably damaging 1.00
R6960:Olfr1289 UTSW 2 111483726 missense possibly damaging 0.70
R7293:Olfr1289 UTSW 2 111483354 splice site probably null
R7642:Olfr1289 UTSW 2 111483478 missense probably damaging 0.96
R8447:Olfr1289 UTSW 2 111483756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGACCTTAATGGGTGAGC -3'
(R):5'- GCCCTTAACAGAGATGACTTTGC -3'

Sequencing Primer
(F):5'- CCTTAATGGGTGAGCAGAGG -3'
(R):5'- CCTTAACAGAGATGACTTTGCGTTTG -3'
Posted On2020-10-20