Mutagenetix > Incidental Mutation

Incidental Mutation 'R8429:Ralgapb'

653635

Institutional Source

Beutler Lab

Gene Symbol

Ralgapb

Ensembl Gene

ENSMUSG00000027652

Gene Name

Ral GTPase activating protein, beta subunit (non-catalytic)

Synonyms

B230339M05Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8429 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

158409848-158499253 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 158426297 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 107 (P107S)

Ref Sequence

ENSEMBL: ENSMUSP00000105111 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046274] [ENSMUST00000109485] [ENSMUST00000109486]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000046274
AA Change: P107S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000048430
Gene: ENSMUSG00000027652
AA Change: P107S

Domain	Start	End	E-Value	Type
low complexity region	166	178	N/A	INTRINSIC
low complexity region	610	625	N/A	INTRINSIC
low complexity region	775	788	N/A	INTRINSIC
low complexity region	910	920	N/A	INTRINSIC
low complexity region	1086	1097	N/A	INTRINSIC
low complexity region	1309	1321	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109485
AA Change: P107S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105111
Gene: ENSMUSG00000027652
AA Change: P107S

Domain	Start	End	E-Value	Type
low complexity region	166	178	N/A	INTRINSIC
low complexity region	622	637	N/A	INTRINSIC
low complexity region	791	804	N/A	INTRINSIC
low complexity region	926	936	N/A	INTRINSIC
low complexity region	1102	1113	N/A	INTRINSIC
low complexity region	1325	1337	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109486
AA Change: P107S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105112
Gene: ENSMUSG00000027652
AA Change: P107S

Domain	Start	End	E-Value	Type
low complexity region	166	178	N/A	INTRINSIC
low complexity region	610	625	N/A	INTRINSIC
low complexity region	779	792	N/A	INTRINSIC
low complexity region	914	924	N/A	INTRINSIC
low complexity region	1090	1101	N/A	INTRINSIC
low complexity region	1313	1325	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700122O11Rik	A	T	17: 48,037,066	L143*	probably null	Het
2900026A02Rik	T	C	5: 113,183,436	T971A	probably benign	Het
4932415D10Rik	G	T	10: 82,289,467	Q2570K	possibly damaging	Het
4933425L06Rik	A	G	13: 105,118,788	Y459C	probably damaging	Het
Abca6	A	T	11: 110,202,382	C1022S	probably benign	Het
Adgrf4	G	T	17: 42,667,449	N334K	probably benign	Het
Baz1b	A	G	5: 135,217,331	K545E	probably benign	Het
Bin3	A	G	14: 70,137,149	Y209C	probably damaging	Het
Btbd16	G	A	7: 130,795,337	A223T	probably benign	Het
C3	A	G	17: 57,222,811	V555A	probably damaging	Het
Calm3	T	A	7: 16,919,667		probably null	Het
Cct4	T	A	11: 22,996,030	L124Q	probably damaging	Het
Cenpf	C	T	1: 189,657,307	D1443N	possibly damaging	Het
Egfem1	G	A	3: 29,657,268		probably null	Het
Epha4	G	T	1: 77,390,036	Q591K	probably benign	Het
Fanci	T	C	7: 79,438,385	F929L	possibly damaging	Het
Fnip1	A	T	11: 54,475,696	D95V	possibly damaging	Het
Foxc1	A	T	13: 31,807,776	H190L	probably benign	Het
Gm45713	T	C	7: 45,136,116	S2G	unknown	Het
Grin2b	T	C	6: 135,733,916	I877M	probably damaging	Het
Hadha	T	C	5: 30,144,257	I119V	probably benign	Het
Hcar2	C	T	5: 123,865,475		probably benign	Het
Krt13	A	T	11: 100,121,125	L124Q	probably damaging	Het
Larp1b	A	G	3: 40,977,227	*336W	probably null	Het
Lrmp	C	A	6: 145,165,223	D251E	probably damaging	Het
Man2c1	T	C	9: 57,131,161	L35P	probably damaging	Het
Meioc	A	T	11: 102,674,206	N160I	probably benign	Het
Mfsd2b	G	T	12: 4,866,487	Q331K	possibly damaging	Het
Mical2	T	A	7: 112,345,253	V930E	probably benign	Het
Mrgprb4	A	T	7: 48,198,425	F252I	probably benign	Het
Nars	A	G	18: 64,501,320	Y511H	probably damaging	Het
Naxe	C	A	3: 88,058,152	S84I	probably damaging	Het
Ncam2	A	T	16: 81,589,635	D634V	probably damaging	Het
Npat	C	T	9: 53,570,609	Q1206*	probably null	Het
Nr1d2	G	A	14: 18,215,409	T201I	probably benign	Het
Nup155	C	T	15: 8,112,420	H99Y	probably damaging	Het
Olfr1130	G	T	2: 87,607,524	L45F	probably benign	Het
Olfr1289	G	A	2: 111,483,495	V50I	possibly damaging	Het
Olfr209	A	G	16: 59,361,627	V197A	possibly damaging	Het
Olfr826	A	G	10: 130,180,223	V219A	possibly damaging	Het
Pcnx3	C	T	19: 5,665,384	G1946E	probably damaging	Het
Pde6a	T	A	18: 61,232,844	Y214N	probably damaging	Het
Pex7	T	C	10: 19,894,328	T145A	probably damaging	Het
Plekhj1	C	T	10: 80,796,470	S146N	probably benign	Het
Satb1	A	G	17: 51,767,950	M506T	probably damaging	Het
Sh3gl1	T	C	17: 56,018,821	N203D	possibly damaging	Het
Slc7a12	A	T	3: 14,497,282	I240F	probably benign	Het
Syt17	T	A	7: 118,434,341	Y144F	probably benign	Het
Thbd	G	T	2: 148,407,537	T137K	possibly damaging	Het
Tmem114	A	G	16: 8,412,167	F124L	probably damaging	Het
Ubtd1	G	T	19: 42,032,117		probably null	Het
Zfp458	A	G	13: 67,258,088	Y96H	possibly damaging	Het
Zfp78	T	C	7: 6,378,493	S181P	probably benign	Het

Other mutations in Ralgapb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Ralgapb	APN	2	158420856	missense	probably damaging	1.00
IGL00534:Ralgapb	APN	2	158430500	missense	possibly damaging	0.72
IGL01362:Ralgapb	APN	2	158435465	missense	probably damaging	1.00
IGL01653:Ralgapb	APN	2	158462159	missense	possibly damaging	0.94
IGL01704:Ralgapb	APN	2	158420875	missense	possibly damaging	0.92
IGL02000:Ralgapb	APN	2	158454114	splice site	probably benign
IGL02169:Ralgapb	APN	2	158426204	missense	probably damaging	1.00
IGL02516:Ralgapb	APN	2	158465815	splice site	probably benign
IGL02548:Ralgapb	APN	2	158444665	missense	probably damaging	0.97
IGL02550:Ralgapb	APN	2	158448411	missense	probably damaging	1.00
IGL02653:Ralgapb	APN	2	158443309	missense	probably damaging	1.00
IGL02744:Ralgapb	APN	2	158446151	missense	probably damaging	1.00
IGL02804:Ralgapb	APN	2	158426284	missense	possibly damaging	0.78
IGL02937:Ralgapb	APN	2	158493016	splice site	probably null
IGL02993:Ralgapb	APN	2	158437394	missense	possibly damaging	0.90
IGL03154:Ralgapb	APN	2	158432866	missense	probably damaging	1.00
IGL03204:Ralgapb	APN	2	158465912	missense	possibly damaging	0.67
IGL03347:Ralgapb	APN	2	158465960	missense	possibly damaging	0.67
Chacha	UTSW	2	158492452	missense	probably damaging	0.99
Gato	UTSW	2	158444620	missense	probably damaging	1.00
Kibble	UTSW	2	158437140	missense	probably damaging	1.00
ralston	UTSW	2	158454277	missense	probably damaging	1.00
PIT4142001:Ralgapb	UTSW	2	158430422	missense	probably benign	0.34
R0037:Ralgapb	UTSW	2	158437411	missense	probably damaging	1.00
R0037:Ralgapb	UTSW	2	158437411	missense	probably damaging	1.00
R0077:Ralgapb	UTSW	2	158473249	missense	probably damaging	1.00
R0581:Ralgapb	UTSW	2	158492961	missense	probably benign
R0629:Ralgapb	UTSW	2	158439547	missense	probably damaging	1.00
R0839:Ralgapb	UTSW	2	158473283	critical splice donor site	probably null
R1331:Ralgapb	UTSW	2	158430533	missense	probably damaging	1.00
R1468:Ralgapb	UTSW	2	158462253	missense	possibly damaging	0.95
R1468:Ralgapb	UTSW	2	158462253	missense	possibly damaging	0.95
R1540:Ralgapb	UTSW	2	158465826	missense	probably benign	0.00
R1572:Ralgapb	UTSW	2	158446199	splice site	probably benign
R1628:Ralgapb	UTSW	2	158430463	missense	probably benign	0.04
R1718:Ralgapb	UTSW	2	158443280	nonsense	probably null
R1777:Ralgapb	UTSW	2	158462195	missense	probably damaging	1.00
R1822:Ralgapb	UTSW	2	158492452	missense	probably damaging	0.99
R1903:Ralgapb	UTSW	2	158495563	missense	probably benign	0.04
R1909:Ralgapb	UTSW	2	158444675	missense	probably damaging	1.00
R2157:Ralgapb	UTSW	2	158437472	missense	probably benign	0.15
R4524:Ralgapb	UTSW	2	158437306	missense	probably benign	0.00
R4946:Ralgapb	UTSW	2	158440967	missense	probably damaging	1.00
R4975:Ralgapb	UTSW	2	158435508	missense	possibly damaging	0.66
R5014:Ralgapb	UTSW	2	158495535	missense	probably damaging	1.00
R5165:Ralgapb	UTSW	2	158465912	missense	possibly damaging	0.67
R5465:Ralgapb	UTSW	2	158448405	missense	possibly damaging	0.81
R5526:Ralgapb	UTSW	2	158432785	missense	probably damaging	1.00
R5566:Ralgapb	UTSW	2	158494710	missense	possibly damaging	0.90
R5949:Ralgapb	UTSW	2	158454259	missense	probably damaging	1.00
R6140:Ralgapb	UTSW	2	158456572	missense	probably damaging	1.00
R6175:Ralgapb	UTSW	2	158446155	missense	probably damaging	1.00
R6192:Ralgapb	UTSW	2	158449447	splice site	probably null
R6364:Ralgapb	UTSW	2	158462109	missense	probably damaging	1.00
R6458:Ralgapb	UTSW	2	158444620	missense	probably damaging	1.00
R6746:Ralgapb	UTSW	2	158476136	missense	probably damaging	1.00
R6782:Ralgapb	UTSW	2	158436566	missense	probably damaging	0.99
R6788:Ralgapb	UTSW	2	158436566	missense	probably damaging	0.99
R7017:Ralgapb	UTSW	2	158448337	missense	probably benign	0.19
R7108:Ralgapb	UTSW	2	158492460	missense	probably damaging	0.98
R7108:Ralgapb	UTSW	2	158494662	missense	probably damaging	1.00
R7236:Ralgapb	UTSW	2	158440827	missense	probably benign	0.34
R7454:Ralgapb	UTSW	2	158432902	missense	possibly damaging	0.94
R7485:Ralgapb	UTSW	2	158443355	missense	probably benign	0.35
R7595:Ralgapb	UTSW	2	158426165	missense	possibly damaging	0.91
R7615:Ralgapb	UTSW	2	158450270	missense	probably damaging	0.99
R7728:Ralgapb	UTSW	2	158482503	critical splice donor site	probably null
R7913:Ralgapb	UTSW	2	158465939	missense	probably damaging	1.00
R7953:Ralgapb	UTSW	2	158465883	missense	probably benign	0.10
R8245:Ralgapb	UTSW	2	158443336	missense	probably damaging	0.96
R8337:Ralgapb	UTSW	2	158450272	missense	probably benign	0.11
R8363:Ralgapb	UTSW	2	158426199	missense	probably damaging	1.00
R8673:Ralgapb	UTSW	2	158450213	missense	probably damaging	1.00
R8955:Ralgapb	UTSW	2	158437344	missense	probably benign	0.05
R8955:Ralgapb	UTSW	2	158495469	missense	probably damaging	1.00
R8992:Ralgapb	UTSW	2	158454277	missense	probably damaging	1.00
R9013:Ralgapb	UTSW	2	158437140	missense	probably damaging	1.00
R9141:Ralgapb	UTSW	2	158420891	missense	possibly damaging	0.80
R9166:Ralgapb	UTSW	2	158432922	critical splice donor site	probably null
R9242:Ralgapb	UTSW	2	158435466	missense	probably benign	0.13
R9274:Ralgapb	UTSW	2	158436619	missense	probably damaging	1.00
R9354:Ralgapb	UTSW	2	158437393	missense	possibly damaging	0.90
R9454:Ralgapb	UTSW	2	158473152	missense	probably benign	0.30
R9489:Ralgapb	UTSW	2	158426363	missense	possibly damaging	0.89
R9490:Ralgapb	UTSW	2	158492430	missense	probably benign	0.29
R9510:Ralgapb	UTSW	2	158443936	missense	probably damaging	0.98
Z1177:Ralgapb	UTSW	2	158435555	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCTGGGCACTAGAAGATGTTG -3'
(R):5'- CGTTACATGACCCTGTAAGCC -3'

Sequencing Primer
(F):5'- ATGGACTGACCCTTCCAT -3'
(R):5'- ACATGACCCTGTAAGCCTATATG -3'

Posted On

2020-10-20