Incidental Mutation 'R0302:Trim32'
ID65364
Institutional Source Beutler Lab
Gene Symbol Trim32
Ensembl Gene ENSMUSG00000051675
Gene Nametripartite motif-containing 32
Synonyms1810045E12Rik, Zfp117, BBS11, 3f3
MMRRC Submission 038514-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.910) question?
Stock #R0302 (G1)
Quality Score95
Status Validated
Chromosome4
Chromosomal Location65604986-65616238 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 65613254 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 16 (R16Q)
Ref Sequence ENSEMBL: ENSMUSP00000119579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050850] [ENSMUST00000068214] [ENSMUST00000084496] [ENSMUST00000107366] [ENSMUST00000155978] [ENSMUST00000156922]
Predicted Effect probably damaging
Transcript: ENSMUST00000050850
AA Change: R16Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062277
Gene: ENSMUSG00000051675
AA Change: R16Q

DomainStartEndE-ValueType
RING 21 65 8.61e-9 SMART
BBOX 96 139 3.44e-8 SMART
low complexity region 253 268 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Pfam:NHL 471 498 6.9e-7 PFAM
Pfam:NHL 618 645 4.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068214
SMART Domains Protein: ENSMUSP00000065786
Gene: ENSMUSG00000028373

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 87 127 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
low complexity region 342 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 432 437 N/A INTRINSIC
transmembrane domain 443 465 N/A INTRINSIC
EGF_like 526 563 2.92e1 SMART
Blast:EGF_like 667 708 2e-18 BLAST
EGF_like 715 764 4.03e1 SMART
MACPF 864 1048 2.88e-55 SMART
FN3 1079 1191 2.41e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084496
SMART Domains Protein: ENSMUSP00000081540
Gene: ENSMUSG00000028373

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 87 127 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
low complexity region 341 352 N/A INTRINSIC
low complexity region 380 385 N/A INTRINSIC
transmembrane domain 391 413 N/A INTRINSIC
EGF_like 474 511 2.92e1 SMART
Blast:EGF_like 615 656 2e-18 BLAST
EGF_like 663 712 4.03e1 SMART
MACPF 812 996 2.88e-55 SMART
FN3 1027 1139 2.41e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107366
AA Change: R16Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102989
Gene: ENSMUSG00000051675
AA Change: R16Q

DomainStartEndE-ValueType
RING 21 65 8.61e-9 SMART
BBOX 96 139 3.44e-8 SMART
low complexity region 253 268 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Pfam:NHL 373 400 3.6e-7 PFAM
Pfam:NHL 471 498 2.7e-7 PFAM
Pfam:NHL 618 645 2.5e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155978
AA Change: R16Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119579
Gene: ENSMUSG00000051675
AA Change: R16Q

DomainStartEndE-ValueType
RING 21 65 8.61e-9 SMART
Blast:BBOX 96 136 3e-22 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000156922
AA Change: R16Q

PolyPhen 2 Score 0.517 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121949
Gene: ENSMUSG00000051675
AA Change: R16Q

DomainStartEndE-ValueType
RING 21 65 8.61e-9 SMART
BBOX 96 139 3.44e-8 SMART
Meta Mutation Damage Score 0.1654 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. The protein has also been localized to the nucleus, where it interacts with the activation domain of the HIV-1 Tat protein. The Tat protein activates transcription of HIV-1 genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit mild myopathy with sarcotubular myopathy, decreased fertility, and decreased axon diameter. Mice homozygous for a knock-out allele exhibit impaired adult muscle regeneration and myopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl2 T C 4: 126,317,392 E244G probably benign Het
Aldh1l2 G A 10: 83,520,365 P54S probably damaging Het
Ankdd1a G A 9: 65,509,642 probably benign Het
Ankra2 T A 13: 98,271,692 S216R probably damaging Het
Asah2 A T 19: 32,052,956 N105K probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Cacna1s A G 1: 136,100,604 Y893C probably benign Het
Capza2 G A 6: 17,648,524 R15H probably benign Het
Cbfa2t2 T C 2: 154,534,876 probably benign Het
Ccdc96 A T 5: 36,486,101 T484S possibly damaging Het
Cckar GCTTAGCCTCTTCT GCT 5: 53,700,299 probably null Het
Ccl4 T A 11: 83,663,454 probably benign Het
Cpt1b A G 15: 89,417,870 Y702H probably benign Het
Cr1l G A 1: 195,117,793 T153I probably damaging Het
Cyth2 C A 7: 45,810,585 E57* probably null Het
Daxx T A 17: 33,913,620 S575T probably damaging Het
Depdc5 T C 5: 32,904,546 probably benign Het
Dnah12 A G 14: 26,799,999 D1923G probably damaging Het
Dnah7b A G 1: 46,123,777 T428A probably benign Het
Dnm2 G T 9: 21,500,343 A619S probably benign Het
Enpp2 T C 15: 54,860,061 T639A probably benign Het
Epsti1 A T 14: 77,939,926 H182L probably damaging Het
Exoc3l C T 8: 105,293,543 R250Q probably benign Het
Ggn G T 7: 29,171,240 probably null Het
Il1rap A G 16: 26,692,794 N196S probably benign Het
Ints6 T C 14: 62,709,512 T335A probably damaging Het
Itga1 G A 13: 115,012,318 probably benign Het
Kifc3 G T 8: 95,103,470 Q557K possibly damaging Het
Krt23 A G 11: 99,478,201 I422T probably benign Het
Lcn2 A G 2: 32,384,889 probably benign Het
Lonp2 A G 8: 86,637,991 T326A possibly damaging Het
Lrpprc T C 17: 84,740,078 I909V possibly damaging Het
Lrrc14 G T 15: 76,714,352 R396L probably benign Het
Lypd6 T G 2: 50,165,667 probably benign Het
Man2b1 A G 8: 85,093,016 N610S probably damaging Het
Map2 A T 1: 66,414,828 N959I probably benign Het
Mctp2 C T 7: 72,090,264 V793I possibly damaging Het
Med25 A C 7: 44,880,558 probably benign Het
Mfsd6 T C 1: 52,709,457 Y83C probably damaging Het
Mtbp A T 15: 55,625,424 M499L probably damaging Het
Mtmr10 A T 7: 64,297,497 K53N probably damaging Het
Nfat5 T C 8: 107,358,701 I542T probably damaging Het
Nr1h3 A G 2: 91,192,013 M90T probably damaging Het
Nsmce4a A G 7: 130,545,893 probably benign Het
Olfr1168 T A 2: 88,185,510 I211N possibly damaging Het
Oprl1 G A 2: 181,719,228 C318Y probably benign Het
Pbx3 A T 2: 34,224,560 S46T probably benign Het
Pign A T 1: 105,589,093 F575I possibly damaging Het
Ptpn13 G T 5: 103,565,225 S1738I probably benign Het
Rnf126 G T 10: 79,759,223 P269Q probably damaging Het
Ryr3 G A 2: 112,647,123 probably benign Het
Slc2a7 C T 4: 150,149,521 A31V probably damaging Het
Slc6a12 A G 6: 121,363,259 D487G probably damaging Het
Son G T 16: 91,656,144 G593V probably damaging Het
Spata31d1a T C 13: 59,703,150 N388S probably benign Het
Spg11 A T 2: 122,092,187 M927K possibly damaging Het
Taf13 A G 3: 108,571,722 M1V probably null Het
Trio A G 15: 27,902,517 F286S probably damaging Het
Trpm2 A C 10: 77,943,990 probably benign Het
Ttc7b T C 12: 100,387,179 M390V possibly damaging Het
Vmn1r184 A T 7: 26,267,543 Q238L probably damaging Het
Zfp236 T C 18: 82,658,088 E368G probably damaging Het
Zfr2 G T 10: 81,251,336 probably benign Het
Other mutations in Trim32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02142:Trim32 APN 4 65614499 missense probably damaging 1.00
IGL02534:Trim32 APN 4 65614669 missense possibly damaging 0.72
R0356:Trim32 UTSW 4 65613254 missense probably damaging 1.00
R0358:Trim32 UTSW 4 65613254 missense probably damaging 1.00
R0497:Trim32 UTSW 4 65613254 missense probably damaging 1.00
R0544:Trim32 UTSW 4 65613254 missense probably damaging 1.00
R0547:Trim32 UTSW 4 65613254 missense probably damaging 1.00
R0611:Trim32 UTSW 4 65613656 missense possibly damaging 0.71
R1183:Trim32 UTSW 4 65614391 missense probably benign 0.00
R1523:Trim32 UTSW 4 65614004 missense probably benign 0.04
R1784:Trim32 UTSW 4 65614397 missense probably damaging 0.96
R1939:Trim32 UTSW 4 65614066 missense probably benign
R2069:Trim32 UTSW 4 65614776 nonsense probably null
R2869:Trim32 UTSW 4 65614457 missense probably damaging 1.00
R2869:Trim32 UTSW 4 65614457 missense probably damaging 1.00
R3875:Trim32 UTSW 4 65613466 missense possibly damaging 0.93
R5464:Trim32 UTSW 4 65614388 missense probably damaging 1.00
R6246:Trim32 UTSW 4 65614564 missense probably damaging 1.00
R6610:Trim32 UTSW 4 65615071 missense probably damaging 1.00
Z1177:Trim32 UTSW 4 65614825 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGCCTTACCCAGTTGTCAGGCTC -3'
(R):5'- ATCTTCAGCACCGTCAGGTTGTCG -3'

Sequencing Primer
(F):5'- gtgtgtatgtAAGGGGAGGG -3'
(R):5'- CCGTCAGGTTGTCGGTCAG -3'
Posted On2013-08-08