Incidental Mutation 'R8429:Grin2b'
ID 653644
Institutional Source Beutler Lab
Gene Symbol Grin2b
Ensembl Gene ENSMUSG00000030209
Gene Name glutamate receptor, ionotropic, NMDA2B (epsilon 2)
Synonyms GluRepsilon2, GluN2B, NR2B, NMDAR2B, Nmdar2b
MMRRC Submission 067774-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8429 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 135690231-136150509 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 135710914 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 877 (I877M)
Ref Sequence ENSEMBL: ENSMUSP00000062284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000053880
AA Change: I877M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: I877M

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 106 306 8.6e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 4.8e-270 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111905
AA Change: I877M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: I877M

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 56 307 4.2e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 2.1e-245 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A T 17: 48,347,875 (GRCm39) L143* probably null Het
2900026A02Rik T C 5: 113,331,302 (GRCm39) T971A probably benign Het
Abca6 A T 11: 110,093,208 (GRCm39) C1022S probably benign Het
Adgrf4 G T 17: 42,978,340 (GRCm39) N334K probably benign Het
Baz1b A G 5: 135,246,185 (GRCm39) K545E probably benign Het
Bin3 A G 14: 70,374,598 (GRCm39) Y209C probably damaging Het
Btbd16 G A 7: 130,397,067 (GRCm39) A223T probably benign Het
C3 A G 17: 57,529,811 (GRCm39) V555A probably damaging Het
Calm3 T A 7: 16,653,592 (GRCm39) probably null Het
Cct4 T A 11: 22,946,030 (GRCm39) L124Q probably damaging Het
Cenpf C T 1: 189,389,504 (GRCm39) D1443N possibly damaging Het
Egfem1 G A 3: 29,711,417 (GRCm39) probably null Het
Epha4 G T 1: 77,366,673 (GRCm39) Q591K probably benign Het
Fanci T C 7: 79,088,133 (GRCm39) F929L possibly damaging Het
Fnip1 A T 11: 54,366,522 (GRCm39) D95V possibly damaging Het
Foxc1 A T 13: 31,991,759 (GRCm39) H190L probably benign Het
Gm45713 T C 7: 44,785,540 (GRCm39) S2G unknown Het
Hadha T C 5: 30,349,255 (GRCm39) I119V probably benign Het
Hcar2 C T 5: 124,003,538 (GRCm39) probably benign Het
Irag2 C A 6: 145,110,949 (GRCm39) D251E probably damaging Het
Krt13 A T 11: 100,011,951 (GRCm39) L124Q probably damaging Het
Larp1b A G 3: 40,931,662 (GRCm39) *336W probably null Het
Man2c1 T C 9: 57,038,445 (GRCm39) L35P probably damaging Het
Meioc A T 11: 102,565,032 (GRCm39) N160I probably benign Het
Mfsd2b G T 12: 4,916,487 (GRCm39) Q331K possibly damaging Het
Mical2 T A 7: 111,944,460 (GRCm39) V930E probably benign Het
Mrgprb4 A T 7: 47,848,173 (GRCm39) F252I probably benign Het
Nars1 A G 18: 64,634,391 (GRCm39) Y511H probably damaging Het
Naxe C A 3: 87,965,459 (GRCm39) S84I probably damaging Het
Ncam2 A T 16: 81,386,523 (GRCm39) D634V probably damaging Het
Npat C T 9: 53,481,909 (GRCm39) Q1206* probably null Het
Nr1d2 G A 14: 18,215,409 (GRCm38) T201I probably benign Het
Nt5el A G 13: 105,255,296 (GRCm39) Y459C probably damaging Het
Nup155 C T 15: 8,141,904 (GRCm39) H99Y probably damaging Het
Or10ag60 G T 2: 87,437,868 (GRCm39) L45F probably benign Het
Or4f4b G A 2: 111,313,840 (GRCm39) V50I possibly damaging Het
Or5ac25 A G 16: 59,181,990 (GRCm39) V197A possibly damaging Het
Or9k2b A G 10: 130,016,092 (GRCm39) V219A possibly damaging Het
Pcnx3 C T 19: 5,715,412 (GRCm39) G1946E probably damaging Het
Pde6a T A 18: 61,365,916 (GRCm39) Y214N probably damaging Het
Pex7 T C 10: 19,770,074 (GRCm39) T145A probably damaging Het
Plekhj1 C T 10: 80,632,304 (GRCm39) S146N probably benign Het
Ralgapb C T 2: 158,268,217 (GRCm39) P107S probably damaging Het
Satb1 A G 17: 52,074,978 (GRCm39) M506T probably damaging Het
Sh3gl1 T C 17: 56,325,821 (GRCm39) N203D possibly damaging Het
Slc7a12 A T 3: 14,562,342 (GRCm39) I240F probably benign Het
Spata31h1 G T 10: 82,125,301 (GRCm39) Q2570K possibly damaging Het
Syt17 T A 7: 118,033,564 (GRCm39) Y144F probably benign Het
Thbd G T 2: 148,249,457 (GRCm39) T137K possibly damaging Het
Tmem114 A G 16: 8,230,031 (GRCm39) F124L probably damaging Het
Ubtd1 G T 19: 42,020,556 (GRCm39) probably null Het
Zfp458 A G 13: 67,406,152 (GRCm39) Y96H possibly damaging Het
Zfp78 T C 7: 6,381,492 (GRCm39) S181P probably benign Het
Other mutations in Grin2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Grin2b APN 6 135,713,329 (GRCm39) missense possibly damaging 0.55
IGL00835:Grin2b APN 6 135,710,568 (GRCm39) missense probably damaging 1.00
IGL01401:Grin2b APN 6 135,713,361 (GRCm39) missense probably damaging 1.00
IGL01523:Grin2b APN 6 136,021,263 (GRCm39) missense probably null 0.99
IGL01719:Grin2b APN 6 135,710,379 (GRCm39) missense probably damaging 0.97
IGL01907:Grin2b APN 6 135,710,738 (GRCm39) missense probably damaging 1.00
IGL01996:Grin2b APN 6 135,709,584 (GRCm39) missense probably damaging 1.00
IGL02309:Grin2b APN 6 135,713,470 (GRCm39) missense probably damaging 1.00
IGL02312:Grin2b APN 6 135,716,088 (GRCm39) missense probably damaging 1.00
IGL02409:Grin2b APN 6 136,020,906 (GRCm39) missense possibly damaging 0.89
IGL02527:Grin2b APN 6 135,900,389 (GRCm39) missense probably damaging 1.00
IGL02535:Grin2b APN 6 135,756,367 (GRCm39) missense possibly damaging 0.70
IGL02570:Grin2b APN 6 135,899,996 (GRCm39) missense probably damaging 1.00
IGL02702:Grin2b APN 6 135,716,130 (GRCm39) missense probably damaging 0.99
IGL03001:Grin2b APN 6 135,716,113 (GRCm39) missense probably damaging 1.00
IGL03274:Grin2b APN 6 135,757,253 (GRCm39) missense possibly damaging 0.90
R0055:Grin2b UTSW 6 135,900,201 (GRCm39) missense probably benign
R0055:Grin2b UTSW 6 135,900,201 (GRCm39) missense probably benign
R0164:Grin2b UTSW 6 135,755,646 (GRCm39) splice site probably benign
R0194:Grin2b UTSW 6 135,756,303 (GRCm39) missense probably damaging 1.00
R0594:Grin2b UTSW 6 135,710,927 (GRCm39) missense probably damaging 1.00
R1434:Grin2b UTSW 6 135,820,193 (GRCm39) missense probably benign 0.04
R1928:Grin2b UTSW 6 136,021,044 (GRCm39) missense probably damaging 1.00
R1942:Grin2b UTSW 6 135,709,730 (GRCm39) missense possibly damaging 0.93
R1996:Grin2b UTSW 6 136,021,209 (GRCm39) missense possibly damaging 0.52
R2002:Grin2b UTSW 6 135,710,243 (GRCm39) missense probably damaging 1.00
R2020:Grin2b UTSW 6 135,710,894 (GRCm39) missense probably benign 0.12
R2103:Grin2b UTSW 6 135,757,138 (GRCm39) missense probably benign 0.02
R2127:Grin2b UTSW 6 135,755,698 (GRCm39) missense probably benign 0.03
R2495:Grin2b UTSW 6 135,710,180 (GRCm39) missense probably damaging 1.00
R2656:Grin2b UTSW 6 135,710,427 (GRCm39) missense probably damaging 1.00
R2847:Grin2b UTSW 6 135,717,951 (GRCm39) missense probably damaging 1.00
R2866:Grin2b UTSW 6 135,710,637 (GRCm39) missense probably damaging 1.00
R2867:Grin2b UTSW 6 135,710,637 (GRCm39) missense probably damaging 1.00
R2867:Grin2b UTSW 6 135,710,637 (GRCm39) missense probably damaging 1.00
R3196:Grin2b UTSW 6 135,709,453 (GRCm39) small deletion probably benign
R3418:Grin2b UTSW 6 135,820,108 (GRCm39) missense probably benign 0.02
R3808:Grin2b UTSW 6 135,900,269 (GRCm39) missense probably damaging 0.99
R4028:Grin2b UTSW 6 135,713,433 (GRCm39) missense probably damaging 1.00
R4602:Grin2b UTSW 6 135,755,739 (GRCm39) missense probably damaging 1.00
R4624:Grin2b UTSW 6 135,710,823 (GRCm39) missense probably damaging 0.99
R4677:Grin2b UTSW 6 135,751,870 (GRCm39) missense probably benign 0.13
R4744:Grin2b UTSW 6 135,755,697 (GRCm39) missense probably damaging 1.00
R5020:Grin2b UTSW 6 135,710,405 (GRCm39) missense probably benign 0.01
R5051:Grin2b UTSW 6 135,756,393 (GRCm39) missense possibly damaging 0.84
R5105:Grin2b UTSW 6 135,709,439 (GRCm39) missense probably benign 0.03
R5125:Grin2b UTSW 6 135,900,297 (GRCm39) missense possibly damaging 0.89
R5146:Grin2b UTSW 6 135,756,340 (GRCm39) missense probably damaging 1.00
R5318:Grin2b UTSW 6 135,710,916 (GRCm39) missense probably damaging 0.99
R5349:Grin2b UTSW 6 136,021,281 (GRCm39) missense possibly damaging 0.93
R5426:Grin2b UTSW 6 135,709,366 (GRCm39) missense probably damaging 1.00
R5438:Grin2b UTSW 6 135,713,304 (GRCm39) missense probably damaging 1.00
R5439:Grin2b UTSW 6 135,713,304 (GRCm39) missense probably damaging 1.00
R5440:Grin2b UTSW 6 135,713,304 (GRCm39) missense probably damaging 1.00
R5530:Grin2b UTSW 6 135,710,721 (GRCm39) missense probably benign 0.00
R5603:Grin2b UTSW 6 135,900,395 (GRCm39) missense probably damaging 1.00
R5657:Grin2b UTSW 6 135,710,085 (GRCm39) missense possibly damaging 0.48
R5788:Grin2b UTSW 6 135,717,962 (GRCm39) missense probably benign 0.24
R5941:Grin2b UTSW 6 135,713,371 (GRCm39) missense probably damaging 0.99
R6057:Grin2b UTSW 6 135,710,942 (GRCm39) missense possibly damaging 0.84
R6137:Grin2b UTSW 6 135,900,456 (GRCm39) missense possibly damaging 0.89
R6216:Grin2b UTSW 6 135,749,397 (GRCm39) missense probably damaging 1.00
R6309:Grin2b UTSW 6 135,710,025 (GRCm39) missense probably benign 0.00
R6316:Grin2b UTSW 6 135,757,277 (GRCm39) missense probably benign 0.00
R6419:Grin2b UTSW 6 135,717,965 (GRCm39) missense probably damaging 1.00
R6551:Grin2b UTSW 6 135,710,342 (GRCm39) missense probably damaging 1.00
R6612:Grin2b UTSW 6 135,717,996 (GRCm39) missense probably damaging 1.00
R6616:Grin2b UTSW 6 135,709,549 (GRCm39) missense probably benign
R6647:Grin2b UTSW 6 135,710,108 (GRCm39) missense probably damaging 1.00
R6806:Grin2b UTSW 6 135,751,826 (GRCm39) missense possibly damaging 0.84
R6976:Grin2b UTSW 6 135,757,198 (GRCm39) missense probably benign
R7033:Grin2b UTSW 6 135,900,036 (GRCm39) missense probably damaging 1.00
R7058:Grin2b UTSW 6 135,757,304 (GRCm39) missense probably damaging 0.97
R7144:Grin2b UTSW 6 135,710,474 (GRCm39) missense possibly damaging 0.50
R7190:Grin2b UTSW 6 135,709,946 (GRCm39) missense possibly damaging 0.46
R7238:Grin2b UTSW 6 135,757,249 (GRCm39) missense probably damaging 0.97
R7453:Grin2b UTSW 6 135,717,947 (GRCm39) missense possibly damaging 0.56
R7553:Grin2b UTSW 6 135,749,394 (GRCm39) missense possibly damaging 0.88
R7585:Grin2b UTSW 6 135,756,301 (GRCm39) missense probably damaging 0.99
R7615:Grin2b UTSW 6 135,900,362 (GRCm39) missense probably damaging 1.00
R7632:Grin2b UTSW 6 135,709,553 (GRCm39) missense probably benign 0.02
R7779:Grin2b UTSW 6 135,755,792 (GRCm39) nonsense probably null
R8058:Grin2b UTSW 6 135,710,225 (GRCm39) missense probably damaging 1.00
R8084:Grin2b UTSW 6 135,710,486 (GRCm39) missense probably benign 0.03
R8145:Grin2b UTSW 6 135,709,497 (GRCm39) missense probably benign 0.01
R8308:Grin2b UTSW 6 135,900,074 (GRCm39) missense probably damaging 0.99
R8357:Grin2b UTSW 6 135,709,197 (GRCm39) missense probably benign 0.00
R8379:Grin2b UTSW 6 135,899,967 (GRCm39) missense probably damaging 1.00
R8457:Grin2b UTSW 6 135,709,197 (GRCm39) missense probably benign 0.00
R8746:Grin2b UTSW 6 135,899,985 (GRCm39) missense probably benign 0.02
R8925:Grin2b UTSW 6 135,749,339 (GRCm39) missense probably damaging 0.97
R8927:Grin2b UTSW 6 135,749,339 (GRCm39) missense probably damaging 0.97
R8963:Grin2b UTSW 6 136,021,007 (GRCm39) missense probably damaging 1.00
R9075:Grin2b UTSW 6 135,709,509 (GRCm39) frame shift probably null
R9076:Grin2b UTSW 6 135,709,509 (GRCm39) frame shift probably null
R9172:Grin2b UTSW 6 135,756,255 (GRCm39) missense possibly damaging 0.84
R9520:Grin2b UTSW 6 135,710,399 (GRCm39) missense probably damaging 1.00
R9740:Grin2b UTSW 6 135,899,868 (GRCm39) critical splice donor site probably null
RF001:Grin2b UTSW 6 136,021,238 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CACAGGGTGGGTTATTGTACGAC -3'
(R):5'- AATTCAGCAAACTGCCTGCC -3'

Sequencing Primer
(F):5'- ACGACTTGCAGTCTGAATGC -3'
(R):5'- AAACTGCCTGCCTCACGATTC -3'
Posted On 2020-10-20