Incidental Mutation 'R8429:Mrgprb4'
ID 653649
Institutional Source Beutler Lab
Gene Symbol Mrgprb4
Ensembl Gene ENSMUSG00000070550
Gene Name MAS-related GPR, member B4
Synonyms MrgB4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8429 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 48198070-48199288 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 48198425 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 252 (F252I)
Ref Sequence ENSEMBL: ENSMUSP00000091952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094388]
AlphaFold Q91ZC0
Predicted Effect probably benign
Transcript: ENSMUST00000094388
AA Change: F252I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000091952
Gene: ENSMUSG00000070550
AA Change: F252I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 37 215 6.4e-8 PFAM
Pfam:7tm_1 46 274 7.6e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable, fertile and overtly normal with no apparent alterations in the pattern of axonal innervation of the epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A T 17: 48,037,066 L143* probably null Het
2900026A02Rik T C 5: 113,183,436 T971A probably benign Het
4932415D10Rik G T 10: 82,289,467 Q2570K possibly damaging Het
4933425L06Rik A G 13: 105,118,788 Y459C probably damaging Het
Abca6 A T 11: 110,202,382 C1022S probably benign Het
Adgrf4 G T 17: 42,667,449 N334K probably benign Het
Baz1b A G 5: 135,217,331 K545E probably benign Het
Bin3 A G 14: 70,137,149 Y209C probably damaging Het
Btbd16 G A 7: 130,795,337 A223T probably benign Het
C3 A G 17: 57,222,811 V555A probably damaging Het
Calm3 T A 7: 16,919,667 probably null Het
Cct4 T A 11: 22,996,030 L124Q probably damaging Het
Cenpf C T 1: 189,657,307 D1443N possibly damaging Het
Egfem1 G A 3: 29,657,268 probably null Het
Epha4 G T 1: 77,390,036 Q591K probably benign Het
Fanci T C 7: 79,438,385 F929L possibly damaging Het
Fnip1 A T 11: 54,475,696 D95V possibly damaging Het
Foxc1 A T 13: 31,807,776 H190L probably benign Het
Gm45713 T C 7: 45,136,116 S2G unknown Het
Grin2b T C 6: 135,733,916 I877M probably damaging Het
Hadha T C 5: 30,144,257 I119V probably benign Het
Hcar2 C T 5: 123,865,475 probably benign Het
Krt13 A T 11: 100,121,125 L124Q probably damaging Het
Larp1b A G 3: 40,977,227 *336W probably null Het
Lrmp C A 6: 145,165,223 D251E probably damaging Het
Man2c1 T C 9: 57,131,161 L35P probably damaging Het
Meioc A T 11: 102,674,206 N160I probably benign Het
Mfsd2b G T 12: 4,866,487 Q331K possibly damaging Het
Mical2 T A 7: 112,345,253 V930E probably benign Het
Nars A G 18: 64,501,320 Y511H probably damaging Het
Naxe C A 3: 88,058,152 S84I probably damaging Het
Ncam2 A T 16: 81,589,635 D634V probably damaging Het
Npat C T 9: 53,570,609 Q1206* probably null Het
Nr1d2 G A 14: 18,215,409 T201I probably benign Het
Nup155 C T 15: 8,112,420 H99Y probably damaging Het
Olfr1130 G T 2: 87,607,524 L45F probably benign Het
Olfr1289 G A 2: 111,483,495 V50I possibly damaging Het
Olfr209 A G 16: 59,361,627 V197A possibly damaging Het
Olfr826 A G 10: 130,180,223 V219A possibly damaging Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Pde6a T A 18: 61,232,844 Y214N probably damaging Het
Pex7 T C 10: 19,894,328 T145A probably damaging Het
Plekhj1 C T 10: 80,796,470 S146N probably benign Het
Ralgapb C T 2: 158,426,297 P107S probably damaging Het
Satb1 A G 17: 51,767,950 M506T probably damaging Het
Sh3gl1 T C 17: 56,018,821 N203D possibly damaging Het
Slc7a12 A T 3: 14,497,282 I240F probably benign Het
Syt17 T A 7: 118,434,341 Y144F probably benign Het
Thbd G T 2: 148,407,537 T137K possibly damaging Het
Tmem114 A G 16: 8,412,167 F124L probably damaging Het
Ubtd1 G T 19: 42,032,117 probably null Het
Zfp458 A G 13: 67,258,088 Y96H possibly damaging Het
Zfp78 T C 7: 6,378,493 S181P probably benign Het
Other mutations in Mrgprb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Mrgprb4 APN 7 48198901 missense probably benign
IGL02745:Mrgprb4 APN 7 48198358 missense probably damaging 0.97
R0718:Mrgprb4 UTSW 7 48198553 missense probably benign 0.10
R0849:Mrgprb4 UTSW 7 48199120 missense probably benign 0.24
R1526:Mrgprb4 UTSW 7 48198411 nonsense probably null
R2857:Mrgprb4 UTSW 7 48198336 missense possibly damaging 0.91
R2859:Mrgprb4 UTSW 7 48198336 missense possibly damaging 0.91
R4355:Mrgprb4 UTSW 7 48198701 missense possibly damaging 0.63
R5354:Mrgprb4 UTSW 7 48198329 missense probably benign 0.07
R5636:Mrgprb4 UTSW 7 48198470 missense probably benign 0.02
R5715:Mrgprb4 UTSW 7 48199039 missense probably damaging 1.00
R6180:Mrgprb4 UTSW 7 48198826 missense probably damaging 1.00
R6277:Mrgprb4 UTSW 7 48198901 missense probably benign
R7092:Mrgprb4 UTSW 7 48198236 missense probably benign 0.01
R7301:Mrgprb4 UTSW 7 48198758 missense probably damaging 0.99
R7779:Mrgprb4 UTSW 7 48199147 missense probably benign 0.19
R8077:Mrgprb4 UTSW 7 48198455 missense probably benign 0.00
R8292:Mrgprb4 UTSW 7 48198806 missense probably damaging 1.00
R9000:Mrgprb4 UTSW 7 48199021 missense probably damaging 1.00
R9006:Mrgprb4 UTSW 7 48198595 missense probably benign 0.12
R9106:Mrgprb4 UTSW 7 48198931 missense probably benign 0.43
R9717:Mrgprb4 UTSW 7 48198835 missense possibly damaging 0.96
Z1088:Mrgprb4 UTSW 7 48198682 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GGGACTCACTCAACTACTGTACTAG -3'
(R):5'- TATCTAGCCTGGCCCTGTTG -3'

Sequencing Primer
(F):5'- AGTTCCCCAGACCTTTGCGAAG -3'
(R):5'- CCTGGCCCTGTTGGTGAAG -3'
Posted On 2020-10-20