Incidental Mutation 'R0302:Adprhl2'
ID65365
Institutional Source Beutler Lab
Gene Symbol Adprhl2
Ensembl Gene ENSMUSG00000042558
Gene NameADP-ribosylhydrolase like 2
SynonymsArh3
MMRRC Submission 038514-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0302 (G1)
Quality Score151
Status Validated
Chromosome4
Chromosomal Location126316047-126321703 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126317392 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 244 (E244G)
Ref Sequence ENSEMBL: ENSMUSP00000099677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030658] [ENSMUST00000070132] [ENSMUST00000102616] [ENSMUST00000102617]
PDB Structure
Crystal Structure of mouse ADP-ribosylhydrolase 3 (mARH3) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000030658
SMART Domains Protein: ENSMUSP00000030658
Gene: ENSMUSG00000028845

DomainStartEndE-ValueType
Pfam:Tektin 17 399 2.1e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070132
SMART Domains Protein: ENSMUSP00000070270
Gene: ENSMUSG00000056174

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 25 33 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
low complexity region 72 105 N/A INTRINSIC
Pfam:Collagen 116 168 1.2e-9 PFAM
low complexity region 207 237 N/A INTRINSIC
internal_repeat_1 240 259 1.3e-7 PROSPERO
low complexity region 260 327 N/A INTRINSIC
low complexity region 342 387 N/A INTRINSIC
internal_repeat_1 388 407 1.3e-7 PROSPERO
low complexity region 408 429 N/A INTRINSIC
low complexity region 440 459 N/A INTRINSIC
low complexity region 471 530 N/A INTRINSIC
low complexity region 545 557 N/A INTRINSIC
C1Q 564 699 2.44e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102616
SMART Domains Protein: ENSMUSP00000099676
Gene: ENSMUSG00000028845

DomainStartEndE-ValueType
Pfam:Tektin 17 398 1.9e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102617
AA Change: E244G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099677
Gene: ENSMUSG00000042558
AA Change: E244G

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:ADP_ribosyl_GH 31 344 1.5e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151191
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADP-ribosylglycohydrolase family. The encoded enzyme catalyzes the removal of ADP-ribose from ADP-ribosylated proteins. This enzyme localizes to the mitochondria, in addition to the nucleus and cytoplasm.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 G A 10: 83,520,365 P54S probably damaging Het
Ankdd1a G A 9: 65,509,642 probably benign Het
Ankra2 T A 13: 98,271,692 S216R probably damaging Het
Asah2 A T 19: 32,052,956 N105K probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Cacna1s A G 1: 136,100,604 Y893C probably benign Het
Capza2 G A 6: 17,648,524 R15H probably benign Het
Cbfa2t2 T C 2: 154,534,876 probably benign Het
Ccdc96 A T 5: 36,486,101 T484S possibly damaging Het
Cckar GCTTAGCCTCTTCT GCT 5: 53,700,299 probably null Het
Ccl4 T A 11: 83,663,454 probably benign Het
Cpt1b A G 15: 89,417,870 Y702H probably benign Het
Cr1l G A 1: 195,117,793 T153I probably damaging Het
Cyth2 C A 7: 45,810,585 E57* probably null Het
Daxx T A 17: 33,913,620 S575T probably damaging Het
Depdc5 T C 5: 32,904,546 probably benign Het
Dnah12 A G 14: 26,799,999 D1923G probably damaging Het
Dnah7b A G 1: 46,123,777 T428A probably benign Het
Dnm2 G T 9: 21,500,343 A619S probably benign Het
Enpp2 T C 15: 54,860,061 T639A probably benign Het
Epsti1 A T 14: 77,939,926 H182L probably damaging Het
Exoc3l C T 8: 105,293,543 R250Q probably benign Het
Ggn G T 7: 29,171,240 probably null Het
Il1rap A G 16: 26,692,794 N196S probably benign Het
Ints6 T C 14: 62,709,512 T335A probably damaging Het
Itga1 G A 13: 115,012,318 probably benign Het
Kifc3 G T 8: 95,103,470 Q557K possibly damaging Het
Krt23 A G 11: 99,478,201 I422T probably benign Het
Lcn2 A G 2: 32,384,889 probably benign Het
Lonp2 A G 8: 86,637,991 T326A possibly damaging Het
Lrpprc T C 17: 84,740,078 I909V possibly damaging Het
Lrrc14 G T 15: 76,714,352 R396L probably benign Het
Lypd6 T G 2: 50,165,667 probably benign Het
Man2b1 A G 8: 85,093,016 N610S probably damaging Het
Map2 A T 1: 66,414,828 N959I probably benign Het
Mctp2 C T 7: 72,090,264 V793I possibly damaging Het
Med25 A C 7: 44,880,558 probably benign Het
Mfsd6 T C 1: 52,709,457 Y83C probably damaging Het
Mtbp A T 15: 55,625,424 M499L probably damaging Het
Mtmr10 A T 7: 64,297,497 K53N probably damaging Het
Nfat5 T C 8: 107,358,701 I542T probably damaging Het
Nr1h3 A G 2: 91,192,013 M90T probably damaging Het
Nsmce4a A G 7: 130,545,893 probably benign Het
Olfr1168 T A 2: 88,185,510 I211N possibly damaging Het
Oprl1 G A 2: 181,719,228 C318Y probably benign Het
Pbx3 A T 2: 34,224,560 S46T probably benign Het
Pign A T 1: 105,589,093 F575I possibly damaging Het
Ptpn13 G T 5: 103,565,225 S1738I probably benign Het
Rnf126 G T 10: 79,759,223 P269Q probably damaging Het
Ryr3 G A 2: 112,647,123 probably benign Het
Slc2a7 C T 4: 150,149,521 A31V probably damaging Het
Slc6a12 A G 6: 121,363,259 D487G probably damaging Het
Son G T 16: 91,656,144 G593V probably damaging Het
Spata31d1a T C 13: 59,703,150 N388S probably benign Het
Spg11 A T 2: 122,092,187 M927K possibly damaging Het
Taf13 A G 3: 108,571,722 M1V probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Trio A G 15: 27,902,517 F286S probably damaging Het
Trpm2 A C 10: 77,943,990 probably benign Het
Ttc7b T C 12: 100,387,179 M390V possibly damaging Het
Vmn1r184 A T 7: 26,267,543 Q238L probably damaging Het
Zfp236 T C 18: 82,658,088 E368G probably damaging Het
Zfr2 G T 10: 81,251,336 probably benign Het
Other mutations in Adprhl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01591:Adprhl2 APN 4 126318481 missense probably damaging 1.00
IGL02391:Adprhl2 APN 4 126317908 splice site probably benign
IGL03189:Adprhl2 APN 4 126317294 splice site probably benign
R0139:Adprhl2 UTSW 4 126318154 missense probably damaging 1.00
R0879:Adprhl2 UTSW 4 126316617 missense probably benign
R2008:Adprhl2 UTSW 4 126317344 missense probably benign 0.05
R3789:Adprhl2 UTSW 4 126316751 missense probably damaging 0.96
R5038:Adprhl2 UTSW 4 126317309 missense possibly damaging 0.69
R5058:Adprhl2 UTSW 4 126318445 missense probably damaging 1.00
R5724:Adprhl2 UTSW 4 126318076 missense probably damaging 1.00
R6171:Adprhl2 UTSW 4 126317317 missense probably damaging 1.00
R6326:Adprhl2 UTSW 4 126316613 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- AGTGTACAAAGCCCAGCTAGGGAC -3'
(R):5'- GGTGGAATTGCCACAAAGCCAAAC -3'

Sequencing Primer
(F):5'- CAGCTAGGGACCCTACAAAGAG -3'
(R):5'- TTAGAAGAGGCCCCTTTGC -3'
Posted On2013-08-08