Incidental Mutation 'R8429:Fanci'
ID 653650
Institutional Source Beutler Lab
Gene Symbol Fanci
Ensembl Gene ENSMUSG00000039187
Gene Name Fanconi anemia, complementation group I
Synonyms
MMRRC Submission 067774-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.651) question?
Stock # R8429 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 79042056-79100013 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 79088133 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 929 (F929L)
Ref Sequence ENSEMBL: ENSMUSP00000044931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036865] [ENSMUST00000132091] [ENSMUST00000137667]
AlphaFold Q8K368
PDB Structure Structure of the FANCI-FANCD2 complex [X-RAY DIFFRACTION]
Structure of a Y DNA-FANCI complex [X-RAY DIFFRACTION]
Structure of FANCI [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036865
AA Change: F929L

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044931
Gene: ENSMUSG00000039187
AA Change: F929L

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 53 7.5e-27 PFAM
Pfam:FANCI_S1 62 280 3.5e-78 PFAM
Pfam:FANCI_HD1 284 370 1.6e-37 PFAM
Pfam:FANCI_S2 378 540 2.4e-63 PFAM
Pfam:FANCI_HD2 554 785 4.8e-87 PFAM
Pfam:FANCI_S3 803 1028 1.7e-83 PFAM
Pfam:FANCI_S4 1041 1295 1.3e-95 PFAM
low complexity region 1299 1307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132091
SMART Domains Protein: ENSMUSP00000122113
Gene: ENSMUSG00000039187

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 53 1.6e-29 PFAM
Pfam:FANCI_S1 60 281 3.2e-81 PFAM
Pfam:FANCI_HD1 284 371 2.9e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137667
SMART Domains Protein: ENSMUSP00000117992
Gene: ENSMUSG00000039187

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 25 7.2e-11 PFAM
Pfam:FANCI_S1 32 253 3.4e-80 PFAM
Pfam:FANCI_HD1 256 343 7.3e-37 PFAM
Pfam:FANCI_S2 349 513 8.5e-56 PFAM
Pfam:FANCI_HD2 523 758 9.3e-99 PFAM
Pfam:FANCI_S3 775 850 1.3e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206121
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group I. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A T 17: 48,347,875 (GRCm39) L143* probably null Het
2900026A02Rik T C 5: 113,331,302 (GRCm39) T971A probably benign Het
Abca6 A T 11: 110,093,208 (GRCm39) C1022S probably benign Het
Adgrf4 G T 17: 42,978,340 (GRCm39) N334K probably benign Het
Baz1b A G 5: 135,246,185 (GRCm39) K545E probably benign Het
Bin3 A G 14: 70,374,598 (GRCm39) Y209C probably damaging Het
Btbd16 G A 7: 130,397,067 (GRCm39) A223T probably benign Het
C3 A G 17: 57,529,811 (GRCm39) V555A probably damaging Het
Calm3 T A 7: 16,653,592 (GRCm39) probably null Het
Cct4 T A 11: 22,946,030 (GRCm39) L124Q probably damaging Het
Cenpf C T 1: 189,389,504 (GRCm39) D1443N possibly damaging Het
Egfem1 G A 3: 29,711,417 (GRCm39) probably null Het
Epha4 G T 1: 77,366,673 (GRCm39) Q591K probably benign Het
Fnip1 A T 11: 54,366,522 (GRCm39) D95V possibly damaging Het
Foxc1 A T 13: 31,991,759 (GRCm39) H190L probably benign Het
Gm45713 T C 7: 44,785,540 (GRCm39) S2G unknown Het
Grin2b T C 6: 135,710,914 (GRCm39) I877M probably damaging Het
Hadha T C 5: 30,349,255 (GRCm39) I119V probably benign Het
Hcar2 C T 5: 124,003,538 (GRCm39) probably benign Het
Irag2 C A 6: 145,110,949 (GRCm39) D251E probably damaging Het
Krt13 A T 11: 100,011,951 (GRCm39) L124Q probably damaging Het
Larp1b A G 3: 40,931,662 (GRCm39) *336W probably null Het
Man2c1 T C 9: 57,038,445 (GRCm39) L35P probably damaging Het
Meioc A T 11: 102,565,032 (GRCm39) N160I probably benign Het
Mfsd2b G T 12: 4,916,487 (GRCm39) Q331K possibly damaging Het
Mical2 T A 7: 111,944,460 (GRCm39) V930E probably benign Het
Mrgprb4 A T 7: 47,848,173 (GRCm39) F252I probably benign Het
Nars1 A G 18: 64,634,391 (GRCm39) Y511H probably damaging Het
Naxe C A 3: 87,965,459 (GRCm39) S84I probably damaging Het
Ncam2 A T 16: 81,386,523 (GRCm39) D634V probably damaging Het
Npat C T 9: 53,481,909 (GRCm39) Q1206* probably null Het
Nr1d2 G A 14: 18,215,409 (GRCm38) T201I probably benign Het
Nt5el A G 13: 105,255,296 (GRCm39) Y459C probably damaging Het
Nup155 C T 15: 8,141,904 (GRCm39) H99Y probably damaging Het
Or10ag60 G T 2: 87,437,868 (GRCm39) L45F probably benign Het
Or4f4b G A 2: 111,313,840 (GRCm39) V50I possibly damaging Het
Or5ac25 A G 16: 59,181,990 (GRCm39) V197A possibly damaging Het
Or9k2b A G 10: 130,016,092 (GRCm39) V219A possibly damaging Het
Pcnx3 C T 19: 5,715,412 (GRCm39) G1946E probably damaging Het
Pde6a T A 18: 61,365,916 (GRCm39) Y214N probably damaging Het
Pex7 T C 10: 19,770,074 (GRCm39) T145A probably damaging Het
Plekhj1 C T 10: 80,632,304 (GRCm39) S146N probably benign Het
Ralgapb C T 2: 158,268,217 (GRCm39) P107S probably damaging Het
Satb1 A G 17: 52,074,978 (GRCm39) M506T probably damaging Het
Sh3gl1 T C 17: 56,325,821 (GRCm39) N203D possibly damaging Het
Slc7a12 A T 3: 14,562,342 (GRCm39) I240F probably benign Het
Spata31h1 G T 10: 82,125,301 (GRCm39) Q2570K possibly damaging Het
Syt17 T A 7: 118,033,564 (GRCm39) Y144F probably benign Het
Thbd G T 2: 148,249,457 (GRCm39) T137K possibly damaging Het
Tmem114 A G 16: 8,230,031 (GRCm39) F124L probably damaging Het
Ubtd1 G T 19: 42,020,556 (GRCm39) probably null Het
Zfp458 A G 13: 67,406,152 (GRCm39) Y96H possibly damaging Het
Zfp78 T C 7: 6,381,492 (GRCm39) S181P probably benign Het
Other mutations in Fanci
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Fanci APN 7 79,062,448 (GRCm39) missense probably damaging 1.00
IGL00718:Fanci APN 7 79,093,922 (GRCm39) missense possibly damaging 0.92
IGL00764:Fanci APN 7 79,045,660 (GRCm39) start codon destroyed probably null 0.05
IGL01669:Fanci APN 7 79,098,925 (GRCm39) missense probably benign 0.01
IGL02338:Fanci APN 7 79,083,279 (GRCm39) nonsense probably null
IGL02428:Fanci APN 7 79,094,264 (GRCm39) intron probably benign
IGL03029:Fanci APN 7 79,093,747 (GRCm39) missense probably benign 0.00
BB005:Fanci UTSW 7 79,094,459 (GRCm39) missense probably benign
BB015:Fanci UTSW 7 79,094,459 (GRCm39) missense probably benign
P0023:Fanci UTSW 7 79,052,048 (GRCm39) missense probably benign 0.00
P0047:Fanci UTSW 7 79,093,792 (GRCm39) missense probably damaging 1.00
R0310:Fanci UTSW 7 79,057,165 (GRCm39) splice site probably benign
R0388:Fanci UTSW 7 79,089,378 (GRCm39) missense probably benign
R0506:Fanci UTSW 7 79,081,926 (GRCm39) missense probably benign 0.29
R0570:Fanci UTSW 7 79,093,711 (GRCm39) missense probably damaging 1.00
R0631:Fanci UTSW 7 79,055,953 (GRCm39) missense probably damaging 1.00
R0746:Fanci UTSW 7 79,089,429 (GRCm39) missense probably damaging 0.99
R0981:Fanci UTSW 7 79,054,914 (GRCm39) missense probably benign 0.01
R1559:Fanci UTSW 7 79,082,941 (GRCm39) missense probably damaging 1.00
R1656:Fanci UTSW 7 79,054,936 (GRCm39) splice site probably benign
R1748:Fanci UTSW 7 79,080,236 (GRCm39) missense probably damaging 1.00
R1815:Fanci UTSW 7 79,088,056 (GRCm39) missense probably damaging 1.00
R2164:Fanci UTSW 7 79,045,743 (GRCm39) missense probably benign 0.22
R3508:Fanci UTSW 7 79,083,220 (GRCm39) missense probably benign 0.01
R3908:Fanci UTSW 7 79,083,257 (GRCm39) missense possibly damaging 0.91
R4036:Fanci UTSW 7 79,094,570 (GRCm39) missense probably damaging 1.00
R4066:Fanci UTSW 7 79,062,505 (GRCm39) critical splice donor site probably null
R4633:Fanci UTSW 7 79,076,990 (GRCm39) missense probably damaging 1.00
R4651:Fanci UTSW 7 79,085,004 (GRCm39) missense possibly damaging 0.74
R4993:Fanci UTSW 7 79,085,126 (GRCm39) makesense probably null
R5341:Fanci UTSW 7 79,055,926 (GRCm39) missense probably damaging 1.00
R5806:Fanci UTSW 7 79,098,596 (GRCm39) missense probably damaging 0.97
R5898:Fanci UTSW 7 79,083,069 (GRCm39) missense probably benign
R5919:Fanci UTSW 7 79,094,486 (GRCm39) missense probably damaging 1.00
R5960:Fanci UTSW 7 79,093,510 (GRCm39) missense probably damaging 1.00
R6367:Fanci UTSW 7 79,075,943 (GRCm39) missense probably damaging 0.99
R6436:Fanci UTSW 7 79,090,446 (GRCm39) missense probably benign 0.03
R6468:Fanci UTSW 7 79,067,687 (GRCm39) missense probably benign 0.10
R6508:Fanci UTSW 7 79,093,516 (GRCm39) missense probably damaging 0.99
R6886:Fanci UTSW 7 79,070,090 (GRCm39) missense possibly damaging 0.81
R7554:Fanci UTSW 7 79,062,500 (GRCm39) missense probably damaging 0.99
R7588:Fanci UTSW 7 79,084,017 (GRCm39) missense possibly damaging 0.81
R7644:Fanci UTSW 7 79,094,219 (GRCm39) nonsense probably null
R7697:Fanci UTSW 7 79,056,040 (GRCm39) critical splice donor site probably null
R7732:Fanci UTSW 7 79,062,400 (GRCm39) missense possibly damaging 0.65
R7928:Fanci UTSW 7 79,094,459 (GRCm39) missense probably benign
R8170:Fanci UTSW 7 79,083,305 (GRCm39) splice site probably null
R8355:Fanci UTSW 7 79,085,029 (GRCm39) missense probably damaging 1.00
R8425:Fanci UTSW 7 79,083,289 (GRCm39) missense probably benign 0.07
R8455:Fanci UTSW 7 79,085,029 (GRCm39) missense probably damaging 1.00
R8720:Fanci UTSW 7 79,089,425 (GRCm39) missense possibly damaging 0.92
R8786:Fanci UTSW 7 79,052,298 (GRCm39) missense probably benign 0.02
R8946:Fanci UTSW 7 79,045,726 (GRCm39) missense probably benign 0.03
R8986:Fanci UTSW 7 79,095,472 (GRCm39) missense probably benign 0.03
R9213:Fanci UTSW 7 79,055,971 (GRCm39) missense possibly damaging 0.70
R9333:Fanci UTSW 7 79,067,594 (GRCm39) missense possibly damaging 0.47
R9485:Fanci UTSW 7 79,089,405 (GRCm39) missense probably benign 0.10
R9508:Fanci UTSW 7 79,083,033 (GRCm39) missense possibly damaging 0.89
R9624:Fanci UTSW 7 79,085,117 (GRCm39) missense probably benign 0.12
R9649:Fanci UTSW 7 79,076,954 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTACACTATGGCGGATG -3'
(R):5'- CAGGTTCTTAATGCTGTGTTCC -3'

Sequencing Primer
(F):5'- CTACACTATGGCGGATGACCAG -3'
(R):5'- CTCCAGTCACTATCTGTGCTTAAATG -3'
Posted On 2020-10-20