Mutagenetix > Incidental Mutation

Incidental Mutation 'R8429:Mical2'

653651

Institutional Source

Beutler Lab

Gene Symbol

Mical2

Ensembl Gene

ENSMUSG00000038244

Gene Name

microtubule associated monooxygenase, calponin and LIM domain containing 2

Synonyms

5330438E18Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.311) question?

Stock #

R8429 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

112225856-112355194 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 112345253 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 930 (V930E)

Ref Sequence

ENSEMBL: ENSMUSP00000047639 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037991] [ENSMUST00000050149]

AlphaFold

Q8BML1
Q9D5U9

Predicted Effect

probably benign
Transcript: ENSMUST00000037991
AA Change: V930E

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000047639
Gene: ENSMUSG00000038244
AA Change: V930E

Domain	Start	End	E-Value	Type
Pfam:FAD_binding_3	86	143	1e-8	PFAM
Pfam:FAD_binding_2	88	127	3.2e-6	PFAM
low complexity region	175	188	N/A	INTRINSIC
low complexity region	500	515	N/A	INTRINSIC
CH	518	617	4.14e-17	SMART
low complexity region	691	700	N/A	INTRINSIC
low complexity region	894	925	N/A	INTRINSIC
LIM	979	1033	9.91e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000050149

SMART Domains

Protein: ENSMUSP00000051163
Gene: ENSMUSG00000038244

Domain	Start	End	E-Value	Type
Pfam:FAD_binding_3	86	143	1.1e-8	PFAM
Pfam:FAD_binding_2	88	127	1.5e-6	PFAM
Pfam:Pyr_redox_2	88	259	1.3e-6	PFAM
low complexity region	500	515	N/A	INTRINSIC
CH	518	617	4.14e-17	SMART
low complexity region	691	700	N/A	INTRINSIC
LIM	752	806	9.91e-10	SMART
low complexity region	918	926	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000144509

SMART Domains

Protein: ENSMUSP00000123341
Gene: ENSMUSG00000038244

Domain	Start	End	E-Value	Type
LIM	14	68	9.91e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000215412

Predicted Effect

probably benign
Transcript: ENSMUST00000216652

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a monooxygenase that enhances depolymerization of F-actin and is therefore involved in cytoskeletal dynamics. The encoded protein is a regulator of the SRF signaling pathway. Increased expression of this gene has been associated with cancer progression and metastasis. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700122O11Rik	A	T	17: 48,037,066	L143*	probably null	Het
2900026A02Rik	T	C	5: 113,183,436	T971A	probably benign	Het
4932415D10Rik	G	T	10: 82,289,467	Q2570K	possibly damaging	Het
4933425L06Rik	A	G	13: 105,118,788	Y459C	probably damaging	Het
Abca6	A	T	11: 110,202,382	C1022S	probably benign	Het
Adgrf4	G	T	17: 42,667,449	N334K	probably benign	Het
Baz1b	A	G	5: 135,217,331	K545E	probably benign	Het
Bin3	A	G	14: 70,137,149	Y209C	probably damaging	Het
Btbd16	G	A	7: 130,795,337	A223T	probably benign	Het
C3	A	G	17: 57,222,811	V555A	probably damaging	Het
Calm3	T	A	7: 16,919,667		probably null	Het
Cct4	T	A	11: 22,996,030	L124Q	probably damaging	Het
Cenpf	C	T	1: 189,657,307	D1443N	possibly damaging	Het
Egfem1	G	A	3: 29,657,268		probably null	Het
Epha4	G	T	1: 77,390,036	Q591K	probably benign	Het
Fanci	T	C	7: 79,438,385	F929L	possibly damaging	Het
Fnip1	A	T	11: 54,475,696	D95V	possibly damaging	Het
Foxc1	A	T	13: 31,807,776	H190L	probably benign	Het
Gm45713	T	C	7: 45,136,116	S2G	unknown	Het
Grin2b	T	C	6: 135,733,916	I877M	probably damaging	Het
Hadha	T	C	5: 30,144,257	I119V	probably benign	Het
Hcar2	C	T	5: 123,865,475		probably benign	Het
Krt13	A	T	11: 100,121,125	L124Q	probably damaging	Het
Larp1b	A	G	3: 40,977,227	*336W	probably null	Het
Lrmp	C	A	6: 145,165,223	D251E	probably damaging	Het
Man2c1	T	C	9: 57,131,161	L35P	probably damaging	Het
Meioc	A	T	11: 102,674,206	N160I	probably benign	Het
Mfsd2b	G	T	12: 4,866,487	Q331K	possibly damaging	Het
Mrgprb4	A	T	7: 48,198,425	F252I	probably benign	Het
Nars	A	G	18: 64,501,320	Y511H	probably damaging	Het
Naxe	C	A	3: 88,058,152	S84I	probably damaging	Het
Ncam2	A	T	16: 81,589,635	D634V	probably damaging	Het
Npat	C	T	9: 53,570,609	Q1206*	probably null	Het
Nr1d2	G	A	14: 18,215,409	T201I	probably benign	Het
Nup155	C	T	15: 8,112,420	H99Y	probably damaging	Het
Olfr1130	G	T	2: 87,607,524	L45F	probably benign	Het
Olfr1289	G	A	2: 111,483,495	V50I	possibly damaging	Het
Olfr209	A	G	16: 59,361,627	V197A	possibly damaging	Het
Olfr826	A	G	10: 130,180,223	V219A	possibly damaging	Het
Pcnx3	C	T	19: 5,665,384	G1946E	probably damaging	Het
Pde6a	T	A	18: 61,232,844	Y214N	probably damaging	Het
Pex7	T	C	10: 19,894,328	T145A	probably damaging	Het
Plekhj1	C	T	10: 80,796,470	S146N	probably benign	Het
Ralgapb	C	T	2: 158,426,297	P107S	probably damaging	Het
Satb1	A	G	17: 51,767,950	M506T	probably damaging	Het
Sh3gl1	T	C	17: 56,018,821	N203D	possibly damaging	Het
Slc7a12	A	T	3: 14,497,282	I240F	probably benign	Het
Syt17	T	A	7: 118,434,341	Y144F	probably benign	Het
Thbd	G	T	2: 148,407,537	T137K	possibly damaging	Het
Tmem114	A	G	16: 8,412,167	F124L	probably damaging	Het
Ubtd1	G	T	19: 42,032,117		probably null	Het
Zfp458	A	G	13: 67,258,088	Y96H	possibly damaging	Het
Zfp78	T	C	7: 6,378,493	S181P	probably benign	Het

Other mutations in Mical2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00886:Mical2	APN	7	112315072	missense	probably benign	0.00
IGL00934:Mical2	APN	7	112349403	missense	probably damaging	1.00
IGL00941:Mical2	APN	7	112321445	splice site	probably benign
IGL01020:Mical2	APN	7	112315076	splice site	probably benign
IGL01395:Mical2	APN	7	112323585	missense	probably damaging	1.00
IGL01658:Mical2	APN	7	112314998	missense	probably damaging	1.00
IGL02040:Mical2	APN	7	112311406	missense	probably damaging	1.00
IGL02388:Mical2	APN	7	112335413	missense	probably benign
IGL02551:Mical2	APN	7	112323990	missense	probably benign	0.01
IGL02578:Mical2	APN	7	112351373	missense	probably benign	0.05
IGL02751:Mical2	APN	7	112332036	missense	probably benign	0.11
R0101:Mical2	UTSW	7	112336867	missense	possibly damaging	0.86
R0504:Mical2	UTSW	7	112271317	missense	probably benign	0.00
R0594:Mical2	UTSW	7	112318450	missense	probably damaging	0.97
R0609:Mical2	UTSW	7	112321440	splice site	probably null
R1542:Mical2	UTSW	7	112309468	missense	probably damaging	1.00
R1740:Mical2	UTSW	7	112333836	missense	probably benign
R1855:Mical2	UTSW	7	112345282	missense	probably benign	0.21
R2086:Mical2	UTSW	7	112318603	missense	probably benign	0.31
R2136:Mical2	UTSW	7	112271515	missense	possibly damaging	0.72
R2418:Mical2	UTSW	7	112320734	critical splice donor site	probably null
R3053:Mical2	UTSW	7	112311423	missense	probably damaging	1.00
R4308:Mical2	UTSW	7	112331992	missense	probably benign	0.27
R4663:Mical2	UTSW	7	112328677	missense	possibly damaging	0.80
R4868:Mical2	UTSW	7	112318624	missense	probably damaging	1.00
R4902:Mical2	UTSW	7	112336900	missense	probably benign
R5112:Mical2	UTSW	7	112320611	missense	probably damaging	1.00
R5487:Mical2	UTSW	7	112320635	missense	probably damaging	1.00
R5563:Mical2	UTSW	7	112314978	missense	probably damaging	1.00
R5817:Mical2	UTSW	7	112323659	missense	probably benign
R5987:Mical2	UTSW	7	112334948	missense	probably benign	0.00
R6087:Mical2	UTSW	7	112318485	nonsense	probably null
R6209:Mical2	UTSW	7	112324086	splice site	probably null
R6311:Mical2	UTSW	7	112323558	missense	probably damaging	1.00
R6319:Mical2	UTSW	7	112328677	missense	possibly damaging	0.80
R6578:Mical2	UTSW	7	112311445	missense	probably damaging	1.00
R6782:Mical2	UTSW	7	112346761	missense	probably damaging	1.00
R7061:Mical2	UTSW	7	112346801	missense	probably benign	0.10
R7147:Mical2	UTSW	7	112323603	missense	possibly damaging	0.77
R7260:Mical2	UTSW	7	112319794	missense	probably benign	0.10
R7266:Mical2	UTSW	7	112303756	missense	probably damaging	1.00
R7391:Mical2	UTSW	7	112320609	missense	probably damaging	1.00
R7724:Mical2	UTSW	7	112323626	missense	probably damaging	1.00
R7747:Mical2	UTSW	7	112333839	missense	probably benign	0.02
R7818:Mical2	UTSW	7	112345307	missense	probably damaging	1.00
R8022:Mical2	UTSW	7	112303767	missense	probably damaging	1.00
R8505:Mical2	UTSW	7	112319800	missense	probably benign	0.02
R8532:Mical2	UTSW	7	112318544	missense	probably damaging	1.00
R8862:Mical2	UTSW	7	112311367	missense	probably damaging	1.00
R8988:Mical2	UTSW	7	112311454	missense	possibly damaging	0.63
R9123:Mical2	UTSW	7	112271382	missense	possibly damaging	0.61
R9127:Mical2	UTSW	7	112271382	missense	possibly damaging	0.61
R9128:Mical2	UTSW	7	112271382	missense	possibly damaging	0.61
R9129:Mical2	UTSW	7	112271382	missense	possibly damaging	0.61
R9187:Mical2	UTSW	7	112303590	nonsense	probably null
R9310:Mical2	UTSW	7	112351713	missense	probably benign	0.45
R9399:Mical2	UTSW	7	112346875	missense	probably damaging	1.00
R9500:Mical2	UTSW	7	112336847	critical splice acceptor site	probably null
R9652:Mical2	UTSW	7	112346789	missense	probably damaging	1.00
R9657:Mical2	UTSW	7	112322599	missense	probably benign	0.37
R9756:Mical2	UTSW	7	112303721	missense	probably damaging	0.99
R9789:Mical2	UTSW	7	112346789	missense	probably damaging	1.00
RF008:Mical2	UTSW	7	112323626	missense	probably damaging	1.00
X0062:Mical2	UTSW	7	112346843	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACTCTGGCATCTACTCCTGG -3'
(R):5'- GGATCCAGCCGACTTTCAAC -3'

Sequencing Primer
(F):5'- GGCATCTACTCCTGGTGGTC -3'
(R):5'- GTTGCCCTGAGAATGGTTCCC -3'

Posted On

2020-10-20