Incidental Mutation 'R8429:Mical2'
ID 653651
Institutional Source Beutler Lab
Gene Symbol Mical2
Ensembl Gene ENSMUSG00000038244
Gene Name microtubule associated monooxygenase, calponin and LIM domain containing 2
Synonyms 5330438E18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock # R8429 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 112225856-112355194 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 112345253 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 930 (V930E)
Ref Sequence ENSEMBL: ENSMUSP00000047639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037991] [ENSMUST00000050149]
AlphaFold Q8BML1
Q9D5U9
Predicted Effect probably benign
Transcript: ENSMUST00000037991
AA Change: V930E

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000047639
Gene: ENSMUSG00000038244
AA Change: V930E

DomainStartEndE-ValueType
Pfam:FAD_binding_3 86 143 1e-8 PFAM
Pfam:FAD_binding_2 88 127 3.2e-6 PFAM
low complexity region 175 188 N/A INTRINSIC
low complexity region 500 515 N/A INTRINSIC
CH 518 617 4.14e-17 SMART
low complexity region 691 700 N/A INTRINSIC
low complexity region 894 925 N/A INTRINSIC
LIM 979 1033 9.91e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050149
SMART Domains Protein: ENSMUSP00000051163
Gene: ENSMUSG00000038244

DomainStartEndE-ValueType
Pfam:FAD_binding_3 86 143 1.1e-8 PFAM
Pfam:FAD_binding_2 88 127 1.5e-6 PFAM
Pfam:Pyr_redox_2 88 259 1.3e-6 PFAM
low complexity region 500 515 N/A INTRINSIC
CH 518 617 4.14e-17 SMART
low complexity region 691 700 N/A INTRINSIC
LIM 752 806 9.91e-10 SMART
low complexity region 918 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144509
SMART Domains Protein: ENSMUSP00000123341
Gene: ENSMUSG00000038244

DomainStartEndE-ValueType
LIM 14 68 9.91e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000215412
Predicted Effect probably benign
Transcript: ENSMUST00000216652
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a monooxygenase that enhances depolymerization of F-actin and is therefore involved in cytoskeletal dynamics. The encoded protein is a regulator of the SRF signaling pathway. Increased expression of this gene has been associated with cancer progression and metastasis. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A T 17: 48,037,066 L143* probably null Het
2900026A02Rik T C 5: 113,183,436 T971A probably benign Het
4932415D10Rik G T 10: 82,289,467 Q2570K possibly damaging Het
4933425L06Rik A G 13: 105,118,788 Y459C probably damaging Het
Abca6 A T 11: 110,202,382 C1022S probably benign Het
Adgrf4 G T 17: 42,667,449 N334K probably benign Het
Baz1b A G 5: 135,217,331 K545E probably benign Het
Bin3 A G 14: 70,137,149 Y209C probably damaging Het
Btbd16 G A 7: 130,795,337 A223T probably benign Het
C3 A G 17: 57,222,811 V555A probably damaging Het
Calm3 T A 7: 16,919,667 probably null Het
Cct4 T A 11: 22,996,030 L124Q probably damaging Het
Cenpf C T 1: 189,657,307 D1443N possibly damaging Het
Egfem1 G A 3: 29,657,268 probably null Het
Epha4 G T 1: 77,390,036 Q591K probably benign Het
Fanci T C 7: 79,438,385 F929L possibly damaging Het
Fnip1 A T 11: 54,475,696 D95V possibly damaging Het
Foxc1 A T 13: 31,807,776 H190L probably benign Het
Gm45713 T C 7: 45,136,116 S2G unknown Het
Grin2b T C 6: 135,733,916 I877M probably damaging Het
Hadha T C 5: 30,144,257 I119V probably benign Het
Hcar2 C T 5: 123,865,475 probably benign Het
Krt13 A T 11: 100,121,125 L124Q probably damaging Het
Larp1b A G 3: 40,977,227 *336W probably null Het
Lrmp C A 6: 145,165,223 D251E probably damaging Het
Man2c1 T C 9: 57,131,161 L35P probably damaging Het
Meioc A T 11: 102,674,206 N160I probably benign Het
Mfsd2b G T 12: 4,866,487 Q331K possibly damaging Het
Mrgprb4 A T 7: 48,198,425 F252I probably benign Het
Nars A G 18: 64,501,320 Y511H probably damaging Het
Naxe C A 3: 88,058,152 S84I probably damaging Het
Ncam2 A T 16: 81,589,635 D634V probably damaging Het
Npat C T 9: 53,570,609 Q1206* probably null Het
Nr1d2 G A 14: 18,215,409 T201I probably benign Het
Nup155 C T 15: 8,112,420 H99Y probably damaging Het
Olfr1130 G T 2: 87,607,524 L45F probably benign Het
Olfr1289 G A 2: 111,483,495 V50I possibly damaging Het
Olfr209 A G 16: 59,361,627 V197A possibly damaging Het
Olfr826 A G 10: 130,180,223 V219A possibly damaging Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Pde6a T A 18: 61,232,844 Y214N probably damaging Het
Pex7 T C 10: 19,894,328 T145A probably damaging Het
Plekhj1 C T 10: 80,796,470 S146N probably benign Het
Ralgapb C T 2: 158,426,297 P107S probably damaging Het
Satb1 A G 17: 51,767,950 M506T probably damaging Het
Sh3gl1 T C 17: 56,018,821 N203D possibly damaging Het
Slc7a12 A T 3: 14,497,282 I240F probably benign Het
Syt17 T A 7: 118,434,341 Y144F probably benign Het
Thbd G T 2: 148,407,537 T137K possibly damaging Het
Tmem114 A G 16: 8,412,167 F124L probably damaging Het
Ubtd1 G T 19: 42,032,117 probably null Het
Zfp458 A G 13: 67,258,088 Y96H possibly damaging Het
Zfp78 T C 7: 6,378,493 S181P probably benign Het
Other mutations in Mical2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Mical2 APN 7 112315072 missense probably benign 0.00
IGL00934:Mical2 APN 7 112349403 missense probably damaging 1.00
IGL00941:Mical2 APN 7 112321445 splice site probably benign
IGL01020:Mical2 APN 7 112315076 splice site probably benign
IGL01395:Mical2 APN 7 112323585 missense probably damaging 1.00
IGL01658:Mical2 APN 7 112314998 missense probably damaging 1.00
IGL02040:Mical2 APN 7 112311406 missense probably damaging 1.00
IGL02388:Mical2 APN 7 112335413 missense probably benign
IGL02551:Mical2 APN 7 112323990 missense probably benign 0.01
IGL02578:Mical2 APN 7 112351373 missense probably benign 0.05
IGL02751:Mical2 APN 7 112332036 missense probably benign 0.11
R0101:Mical2 UTSW 7 112336867 missense possibly damaging 0.86
R0504:Mical2 UTSW 7 112271317 missense probably benign 0.00
R0594:Mical2 UTSW 7 112318450 missense probably damaging 0.97
R0609:Mical2 UTSW 7 112321440 splice site probably null
R1542:Mical2 UTSW 7 112309468 missense probably damaging 1.00
R1740:Mical2 UTSW 7 112333836 missense probably benign
R1855:Mical2 UTSW 7 112345282 missense probably benign 0.21
R2086:Mical2 UTSW 7 112318603 missense probably benign 0.31
R2136:Mical2 UTSW 7 112271515 missense possibly damaging 0.72
R2418:Mical2 UTSW 7 112320734 critical splice donor site probably null
R3053:Mical2 UTSW 7 112311423 missense probably damaging 1.00
R4308:Mical2 UTSW 7 112331992 missense probably benign 0.27
R4663:Mical2 UTSW 7 112328677 missense possibly damaging 0.80
R4868:Mical2 UTSW 7 112318624 missense probably damaging 1.00
R4902:Mical2 UTSW 7 112336900 missense probably benign
R5112:Mical2 UTSW 7 112320611 missense probably damaging 1.00
R5487:Mical2 UTSW 7 112320635 missense probably damaging 1.00
R5563:Mical2 UTSW 7 112314978 missense probably damaging 1.00
R5817:Mical2 UTSW 7 112323659 missense probably benign
R5987:Mical2 UTSW 7 112334948 missense probably benign 0.00
R6087:Mical2 UTSW 7 112318485 nonsense probably null
R6209:Mical2 UTSW 7 112324086 splice site probably null
R6311:Mical2 UTSW 7 112323558 missense probably damaging 1.00
R6319:Mical2 UTSW 7 112328677 missense possibly damaging 0.80
R6578:Mical2 UTSW 7 112311445 missense probably damaging 1.00
R6782:Mical2 UTSW 7 112346761 missense probably damaging 1.00
R7061:Mical2 UTSW 7 112346801 missense probably benign 0.10
R7147:Mical2 UTSW 7 112323603 missense possibly damaging 0.77
R7260:Mical2 UTSW 7 112319794 missense probably benign 0.10
R7266:Mical2 UTSW 7 112303756 missense probably damaging 1.00
R7391:Mical2 UTSW 7 112320609 missense probably damaging 1.00
R7724:Mical2 UTSW 7 112323626 missense probably damaging 1.00
R7747:Mical2 UTSW 7 112333839 missense probably benign 0.02
R7818:Mical2 UTSW 7 112345307 missense probably damaging 1.00
R8022:Mical2 UTSW 7 112303767 missense probably damaging 1.00
R8505:Mical2 UTSW 7 112319800 missense probably benign 0.02
R8532:Mical2 UTSW 7 112318544 missense probably damaging 1.00
R8862:Mical2 UTSW 7 112311367 missense probably damaging 1.00
R8988:Mical2 UTSW 7 112311454 missense possibly damaging 0.63
R9123:Mical2 UTSW 7 112271382 missense possibly damaging 0.61
R9127:Mical2 UTSW 7 112271382 missense possibly damaging 0.61
R9128:Mical2 UTSW 7 112271382 missense possibly damaging 0.61
R9129:Mical2 UTSW 7 112271382 missense possibly damaging 0.61
R9187:Mical2 UTSW 7 112303590 nonsense probably null
R9310:Mical2 UTSW 7 112351713 missense probably benign 0.45
R9399:Mical2 UTSW 7 112346875 missense probably damaging 1.00
R9500:Mical2 UTSW 7 112336847 critical splice acceptor site probably null
R9652:Mical2 UTSW 7 112346789 missense probably damaging 1.00
R9657:Mical2 UTSW 7 112322599 missense probably benign 0.37
R9756:Mical2 UTSW 7 112303721 missense probably damaging 0.99
R9789:Mical2 UTSW 7 112346789 missense probably damaging 1.00
RF008:Mical2 UTSW 7 112323626 missense probably damaging 1.00
X0062:Mical2 UTSW 7 112346843 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCTGGCATCTACTCCTGG -3'
(R):5'- GGATCCAGCCGACTTTCAAC -3'

Sequencing Primer
(F):5'- GGCATCTACTCCTGGTGGTC -3'
(R):5'- GTTGCCCTGAGAATGGTTCCC -3'
Posted On 2020-10-20