Incidental Mutation 'R8429:Syt17'
ID 653652
Institutional Source Beutler Lab
Gene Symbol Syt17
Ensembl Gene ENSMUSG00000058420
Gene Name synaptotagmin XVII
Synonyms Bk
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8429 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 118380717-118448222 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 118434341 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 144 (Y144F)
Ref Sequence ENSEMBL: ENSMUSP00000080284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081574] [ENSMUST00000203465] [ENSMUST00000203485] [ENSMUST00000203796] [ENSMUST00000207034]
AlphaFold Q920M7
Predicted Effect probably benign
Transcript: ENSMUST00000081574
AA Change: Y144F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080284
Gene: ENSMUSG00000058420
AA Change: Y144F

DomainStartEndE-ValueType
low complexity region 90 102 N/A INTRINSIC
low complexity region 103 118 N/A INTRINSIC
low complexity region 159 172 N/A INTRINSIC
C2 196 305 7.92e-19 SMART
low complexity region 315 328 N/A INTRINSIC
C2 333 448 2.8e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203465
AA Change: Y143F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000203485
AA Change: Y148F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000144987
Gene: ENSMUSG00000058420
AA Change: Y148F

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
low complexity region 107 122 N/A INTRINSIC
low complexity region 163 176 N/A INTRINSIC
C2 200 309 5.2e-21 SMART
low complexity region 319 332 N/A INTRINSIC
C2 337 419 3.1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203796
AA Change: Y87F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145087
Gene: ENSMUSG00000058420
AA Change: Y87F

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
low complexity region 46 61 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
C2 139 248 5.2e-21 SMART
low complexity region 258 271 N/A INTRINSIC
C2 276 391 1.9e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207034
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A T 17: 48,037,066 L143* probably null Het
2900026A02Rik T C 5: 113,183,436 T971A probably benign Het
4932415D10Rik G T 10: 82,289,467 Q2570K possibly damaging Het
4933425L06Rik A G 13: 105,118,788 Y459C probably damaging Het
Abca6 A T 11: 110,202,382 C1022S probably benign Het
Adgrf4 G T 17: 42,667,449 N334K probably benign Het
Baz1b A G 5: 135,217,331 K545E probably benign Het
Bin3 A G 14: 70,137,149 Y209C probably damaging Het
Btbd16 G A 7: 130,795,337 A223T probably benign Het
C3 A G 17: 57,222,811 V555A probably damaging Het
Calm3 T A 7: 16,919,667 probably null Het
Cct4 T A 11: 22,996,030 L124Q probably damaging Het
Cenpf C T 1: 189,657,307 D1443N possibly damaging Het
Egfem1 G A 3: 29,657,268 probably null Het
Epha4 G T 1: 77,390,036 Q591K probably benign Het
Fanci T C 7: 79,438,385 F929L possibly damaging Het
Fnip1 A T 11: 54,475,696 D95V possibly damaging Het
Foxc1 A T 13: 31,807,776 H190L probably benign Het
Gm45713 T C 7: 45,136,116 S2G unknown Het
Grin2b T C 6: 135,733,916 I877M probably damaging Het
Hadha T C 5: 30,144,257 I119V probably benign Het
Hcar2 C T 5: 123,865,475 probably benign Het
Krt13 A T 11: 100,121,125 L124Q probably damaging Het
Larp1b A G 3: 40,977,227 *336W probably null Het
Lrmp C A 6: 145,165,223 D251E probably damaging Het
Man2c1 T C 9: 57,131,161 L35P probably damaging Het
Meioc A T 11: 102,674,206 N160I probably benign Het
Mfsd2b G T 12: 4,866,487 Q331K possibly damaging Het
Mical2 T A 7: 112,345,253 V930E probably benign Het
Mrgprb4 A T 7: 48,198,425 F252I probably benign Het
Nars A G 18: 64,501,320 Y511H probably damaging Het
Naxe C A 3: 88,058,152 S84I probably damaging Het
Ncam2 A T 16: 81,589,635 D634V probably damaging Het
Npat C T 9: 53,570,609 Q1206* probably null Het
Nr1d2 G A 14: 18,215,409 T201I probably benign Het
Nup155 C T 15: 8,112,420 H99Y probably damaging Het
Olfr1130 G T 2: 87,607,524 L45F probably benign Het
Olfr1289 G A 2: 111,483,495 V50I possibly damaging Het
Olfr209 A G 16: 59,361,627 V197A possibly damaging Het
Olfr826 A G 10: 130,180,223 V219A possibly damaging Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Pde6a T A 18: 61,232,844 Y214N probably damaging Het
Pex7 T C 10: 19,894,328 T145A probably damaging Het
Plekhj1 C T 10: 80,796,470 S146N probably benign Het
Ralgapb C T 2: 158,426,297 P107S probably damaging Het
Satb1 A G 17: 51,767,950 M506T probably damaging Het
Sh3gl1 T C 17: 56,018,821 N203D possibly damaging Het
Slc7a12 A T 3: 14,497,282 I240F probably benign Het
Thbd G T 2: 148,407,537 T137K possibly damaging Het
Tmem114 A G 16: 8,412,167 F124L probably damaging Het
Ubtd1 G T 19: 42,032,117 probably null Het
Zfp458 A G 13: 67,258,088 Y96H possibly damaging Het
Zfp78 T C 7: 6,378,493 S181P probably benign Het
Other mutations in Syt17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Syt17 APN 7 118434290 missense probably damaging 0.98
IGL01135:Syt17 APN 7 118382047 missense possibly damaging 0.92
IGL01331:Syt17 APN 7 118408166 missense probably damaging 0.99
IGL01610:Syt17 APN 7 118433993 missense possibly damaging 0.90
IGL01776:Syt17 APN 7 118409953 missense probably damaging 0.99
IGL02125:Syt17 APN 7 118409974 missense probably benign 0.01
IGL02819:Syt17 APN 7 118409920 splice site probably benign
H8562:Syt17 UTSW 7 118408069 missense probably benign 0.01
R0127:Syt17 UTSW 7 118409941 missense probably damaging 0.98
R0328:Syt17 UTSW 7 118381993 missense probably benign 0.28
R1789:Syt17 UTSW 7 118436838 missense probably benign 0.00
R1872:Syt17 UTSW 7 118408118 missense probably benign 0.00
R1878:Syt17 UTSW 7 118434245 missense probably benign 0.01
R1918:Syt17 UTSW 7 118433985 missense possibly damaging 0.54
R2133:Syt17 UTSW 7 118382047 missense possibly damaging 0.92
R3777:Syt17 UTSW 7 118433957 missense probably damaging 1.00
R4471:Syt17 UTSW 7 118436817 splice site probably null
R4472:Syt17 UTSW 7 118436817 splice site probably null
R4567:Syt17 UTSW 7 118434272 missense probably benign 0.06
R5211:Syt17 UTSW 7 118442403 missense probably benign 0.19
R5905:Syt17 UTSW 7 118436918 missense probably benign 0.10
R6054:Syt17 UTSW 7 118408133 missense possibly damaging 0.91
R6276:Syt17 UTSW 7 118434290 missense probably damaging 0.98
R6332:Syt17 UTSW 7 118434243 missense probably benign 0.00
R7022:Syt17 UTSW 7 118408019 missense probably benign 0.00
R7440:Syt17 UTSW 7 118381884 missense probably damaging 1.00
R7610:Syt17 UTSW 7 118434459 splice site probably null
R7845:Syt17 UTSW 7 118409971 missense possibly damaging 0.79
R8294:Syt17 UTSW 7 118410005 missense probably damaging 0.99
R8296:Syt17 UTSW 7 118436846 missense probably damaging 0.97
R8949:Syt17 UTSW 7 118433831 critical splice donor site probably null
R9278:Syt17 UTSW 7 118434257 missense probably damaging 1.00
R9622:Syt17 UTSW 7 118436968 missense probably benign
R9629:Syt17 UTSW 7 118408156 missense probably damaging 0.96
Z1177:Syt17 UTSW 7 118434223 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CCATCATGGGAGATTGGAGGTG -3'
(R):5'- ATTGAAGCAGAGAAGCCCGC -3'

Sequencing Primer
(F):5'- ATTGGAGGTGGCAGGTCCC -3'
(R):5'- CGTGGGCGTCTGGGGAC -3'
Posted On 2020-10-20