Incidental Mutation 'R8429:Meioc'
ID 653663
Institutional Source Beutler Lab
Gene Symbol Meioc
Ensembl Gene ENSMUSG00000051455
Gene Name meiosis specific with coiled-coil domain
Synonyms LOC380729, LOC268491, Gm1564
MMRRC Submission 067774-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R8429 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 102556177-102573066 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 102565032 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 160 (N160I)
Ref Sequence ENSEMBL: ENSMUSP00000116246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100378] [ENSMUST00000156590]
AlphaFold A2AG06
Predicted Effect probably benign
Transcript: ENSMUST00000100378
AA Change: N216I

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097947
Gene: ENSMUSG00000051455
AA Change: N216I

DomainStartEndE-ValueType
low complexity region 526 537 N/A INTRINSIC
low complexity region 712 728 N/A INTRINSIC
Pfam:DUF4582 757 922 5.1e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156590
AA Change: N160I

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000116246
Gene: ENSMUSG00000051455
AA Change: N160I

DomainStartEndE-ValueType
low complexity region 470 481 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit infertility with small gonads, absent germ cells and arrested meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A T 17: 48,347,875 (GRCm39) L143* probably null Het
2900026A02Rik T C 5: 113,331,302 (GRCm39) T971A probably benign Het
Abca6 A T 11: 110,093,208 (GRCm39) C1022S probably benign Het
Adgrf4 G T 17: 42,978,340 (GRCm39) N334K probably benign Het
Baz1b A G 5: 135,246,185 (GRCm39) K545E probably benign Het
Bin3 A G 14: 70,374,598 (GRCm39) Y209C probably damaging Het
Btbd16 G A 7: 130,397,067 (GRCm39) A223T probably benign Het
C3 A G 17: 57,529,811 (GRCm39) V555A probably damaging Het
Calm3 T A 7: 16,653,592 (GRCm39) probably null Het
Cct4 T A 11: 22,946,030 (GRCm39) L124Q probably damaging Het
Cenpf C T 1: 189,389,504 (GRCm39) D1443N possibly damaging Het
Egfem1 G A 3: 29,711,417 (GRCm39) probably null Het
Epha4 G T 1: 77,366,673 (GRCm39) Q591K probably benign Het
Fanci T C 7: 79,088,133 (GRCm39) F929L possibly damaging Het
Fnip1 A T 11: 54,366,522 (GRCm39) D95V possibly damaging Het
Foxc1 A T 13: 31,991,759 (GRCm39) H190L probably benign Het
Gm45713 T C 7: 44,785,540 (GRCm39) S2G unknown Het
Grin2b T C 6: 135,710,914 (GRCm39) I877M probably damaging Het
Hadha T C 5: 30,349,255 (GRCm39) I119V probably benign Het
Hcar2 C T 5: 124,003,538 (GRCm39) probably benign Het
Irag2 C A 6: 145,110,949 (GRCm39) D251E probably damaging Het
Krt13 A T 11: 100,011,951 (GRCm39) L124Q probably damaging Het
Larp1b A G 3: 40,931,662 (GRCm39) *336W probably null Het
Man2c1 T C 9: 57,038,445 (GRCm39) L35P probably damaging Het
Mfsd2b G T 12: 4,916,487 (GRCm39) Q331K possibly damaging Het
Mical2 T A 7: 111,944,460 (GRCm39) V930E probably benign Het
Mrgprb4 A T 7: 47,848,173 (GRCm39) F252I probably benign Het
Nars1 A G 18: 64,634,391 (GRCm39) Y511H probably damaging Het
Naxe C A 3: 87,965,459 (GRCm39) S84I probably damaging Het
Ncam2 A T 16: 81,386,523 (GRCm39) D634V probably damaging Het
Npat C T 9: 53,481,909 (GRCm39) Q1206* probably null Het
Nr1d2 G A 14: 18,215,409 (GRCm38) T201I probably benign Het
Nt5el A G 13: 105,255,296 (GRCm39) Y459C probably damaging Het
Nup155 C T 15: 8,141,904 (GRCm39) H99Y probably damaging Het
Or10ag60 G T 2: 87,437,868 (GRCm39) L45F probably benign Het
Or4f4b G A 2: 111,313,840 (GRCm39) V50I possibly damaging Het
Or5ac25 A G 16: 59,181,990 (GRCm39) V197A possibly damaging Het
Or9k2b A G 10: 130,016,092 (GRCm39) V219A possibly damaging Het
Pcnx3 C T 19: 5,715,412 (GRCm39) G1946E probably damaging Het
Pde6a T A 18: 61,365,916 (GRCm39) Y214N probably damaging Het
Pex7 T C 10: 19,770,074 (GRCm39) T145A probably damaging Het
Plekhj1 C T 10: 80,632,304 (GRCm39) S146N probably benign Het
Ralgapb C T 2: 158,268,217 (GRCm39) P107S probably damaging Het
Satb1 A G 17: 52,074,978 (GRCm39) M506T probably damaging Het
Sh3gl1 T C 17: 56,325,821 (GRCm39) N203D possibly damaging Het
Slc7a12 A T 3: 14,562,342 (GRCm39) I240F probably benign Het
Spata31h1 G T 10: 82,125,301 (GRCm39) Q2570K possibly damaging Het
Syt17 T A 7: 118,033,564 (GRCm39) Y144F probably benign Het
Thbd G T 2: 148,249,457 (GRCm39) T137K possibly damaging Het
Tmem114 A G 16: 8,230,031 (GRCm39) F124L probably damaging Het
Ubtd1 G T 19: 42,020,556 (GRCm39) probably null Het
Zfp458 A G 13: 67,406,152 (GRCm39) Y96H possibly damaging Het
Zfp78 T C 7: 6,381,492 (GRCm39) S181P probably benign Het
Other mutations in Meioc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Meioc APN 11 102,565,113 (GRCm39) missense probably benign 0.33
IGL01952:Meioc APN 11 102,563,011 (GRCm39) missense possibly damaging 0.79
IGL02006:Meioc APN 11 102,565,092 (GRCm39) missense probably damaging 1.00
IGL02195:Meioc APN 11 102,565,683 (GRCm39) missense possibly damaging 0.91
IGL02339:Meioc APN 11 102,559,274 (GRCm39) missense probably benign 0.18
IGL02935:Meioc APN 11 102,563,017 (GRCm39) missense probably benign 0.06
IGL03294:Meioc APN 11 102,571,495 (GRCm39) missense probably damaging 1.00
PIT4519001:Meioc UTSW 11 102,570,783 (GRCm39) missense probably damaging 1.00
R0285:Meioc UTSW 11 102,563,017 (GRCm39) missense probably benign 0.06
R0964:Meioc UTSW 11 102,570,857 (GRCm39) missense probably damaging 1.00
R1074:Meioc UTSW 11 102,566,219 (GRCm39) missense probably damaging 1.00
R2024:Meioc UTSW 11 102,566,184 (GRCm39) missense probably benign 0.00
R4012:Meioc UTSW 11 102,566,654 (GRCm39) missense probably damaging 0.99
R4429:Meioc UTSW 11 102,566,546 (GRCm39) missense probably damaging 1.00
R4491:Meioc UTSW 11 102,565,746 (GRCm39) missense possibly damaging 0.84
R4594:Meioc UTSW 11 102,564,992 (GRCm39) missense probably damaging 1.00
R4752:Meioc UTSW 11 102,565,259 (GRCm39) missense probably benign 0.00
R5301:Meioc UTSW 11 102,570,871 (GRCm39) missense probably damaging 1.00
R5352:Meioc UTSW 11 102,566,139 (GRCm39) missense probably benign 0.03
R5646:Meioc UTSW 11 102,566,083 (GRCm39) missense possibly damaging 0.94
R5958:Meioc UTSW 11 102,565,979 (GRCm39) missense probably benign 0.41
R5968:Meioc UTSW 11 102,566,657 (GRCm39) missense probably damaging 0.99
R6157:Meioc UTSW 11 102,559,227 (GRCm39) missense probably damaging 1.00
R6410:Meioc UTSW 11 102,565,860 (GRCm39) missense probably benign 0.00
R6644:Meioc UTSW 11 102,559,286 (GRCm39) critical splice donor site probably null
R7285:Meioc UTSW 11 102,557,168 (GRCm39) missense probably benign 0.00
R7440:Meioc UTSW 11 102,565,063 (GRCm39) missense possibly damaging 0.67
R7815:Meioc UTSW 11 102,566,414 (GRCm39) missense probably damaging 1.00
R7984:Meioc UTSW 11 102,565,432 (GRCm39) missense possibly damaging 0.94
R8009:Meioc UTSW 11 102,567,569 (GRCm39) missense probably damaging 1.00
R8078:Meioc UTSW 11 102,559,226 (GRCm39) nonsense probably null
R8195:Meioc UTSW 11 102,565,893 (GRCm39) nonsense probably null
R8797:Meioc UTSW 11 102,567,686 (GRCm39) nonsense probably null
R8854:Meioc UTSW 11 102,566,589 (GRCm39) missense probably damaging 0.98
R8891:Meioc UTSW 11 102,559,246 (GRCm39) missense probably benign 0.43
R9081:Meioc UTSW 11 102,565,001 (GRCm39) missense probably benign 0.00
R9360:Meioc UTSW 11 102,565,779 (GRCm39) missense probably benign 0.13
R9539:Meioc UTSW 11 102,565,506 (GRCm39) missense probably damaging 0.99
R9549:Meioc UTSW 11 102,556,550 (GRCm39) intron probably benign
R9751:Meioc UTSW 11 102,566,419 (GRCm39) nonsense probably null
Z1177:Meioc UTSW 11 102,557,190 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATGTTTACTTGTTCTAGGACCTGC -3'
(R):5'- ATTCTTTCATGATATCAGACAGGCC -3'

Sequencing Primer
(F):5'- GCTCCTCCAACTTAAAGTCAGTTTGG -3'
(R):5'- CTGTGGTGTAAAACAGTTTTTGAC -3'
Posted On 2020-10-20