Incidental Mutation 'R8429:Mfsd2b'
ID 653665
Institutional Source Beutler Lab
Gene Symbol Mfsd2b
Ensembl Gene ENSMUSG00000037336
Gene Name major facilitator superfamily domain containing 2B
Synonyms Gm1964
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8429 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 4862440-4874359 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 4866487 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 331 (Q331K)
Ref Sequence ENSEMBL: ENSMUSP00000045315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045921] [ENSMUST00000085790] [ENSMUST00000137337] [ENSMUST00000147241]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000045921
AA Change: Q331K

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045315
Gene: ENSMUSG00000037336
AA Change: Q331K

DomainStartEndE-ValueType
Pfam:MFS_2 33 472 4.6e-74 PFAM
low complexity region 476 490 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000085790
AA Change: Q331K

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000082945
Gene: ENSMUSG00000037336
AA Change: Q331K

DomainStartEndE-ValueType
Pfam:MFS_2 32 346 2.2e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000137337
AA Change: Q228K

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117057
Gene: ENSMUSG00000037336
AA Change: Q228K

DomainStartEndE-ValueType
Pfam:MFS_2 1 368 1.1e-59 PFAM
low complexity region 373 387 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147241
SMART Domains Protein: ENSMUSP00000114977
Gene: ENSMUSG00000037336

DomainStartEndE-ValueType
Pfam:MFS_2 33 110 3.1e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous KO reduces sphingosine-1-phosphate export from, and increases its accumulation in, red blood cells and platelets, and leads to reduced leukocyte, reticulocyte, and erythrocyte cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A T 17: 48,037,066 L143* probably null Het
2900026A02Rik T C 5: 113,183,436 T971A probably benign Het
4932415D10Rik G T 10: 82,289,467 Q2570K possibly damaging Het
4933425L06Rik A G 13: 105,118,788 Y459C probably damaging Het
Abca6 A T 11: 110,202,382 C1022S probably benign Het
Adgrf4 G T 17: 42,667,449 N334K probably benign Het
Baz1b A G 5: 135,217,331 K545E probably benign Het
Bin3 A G 14: 70,137,149 Y209C probably damaging Het
Btbd16 G A 7: 130,795,337 A223T probably benign Het
C3 A G 17: 57,222,811 V555A probably damaging Het
Calm3 T A 7: 16,919,667 probably null Het
Cct4 T A 11: 22,996,030 L124Q probably damaging Het
Cenpf C T 1: 189,657,307 D1443N possibly damaging Het
Egfem1 G A 3: 29,657,268 probably null Het
Epha4 G T 1: 77,390,036 Q591K probably benign Het
Fanci T C 7: 79,438,385 F929L possibly damaging Het
Fnip1 A T 11: 54,475,696 D95V possibly damaging Het
Foxc1 A T 13: 31,807,776 H190L probably benign Het
Gm45713 T C 7: 45,136,116 S2G unknown Het
Grin2b T C 6: 135,733,916 I877M probably damaging Het
Hadha T C 5: 30,144,257 I119V probably benign Het
Hcar2 C T 5: 123,865,475 probably benign Het
Krt13 A T 11: 100,121,125 L124Q probably damaging Het
Larp1b A G 3: 40,977,227 *336W probably null Het
Lrmp C A 6: 145,165,223 D251E probably damaging Het
Man2c1 T C 9: 57,131,161 L35P probably damaging Het
Meioc A T 11: 102,674,206 N160I probably benign Het
Mical2 T A 7: 112,345,253 V930E probably benign Het
Mrgprb4 A T 7: 48,198,425 F252I probably benign Het
Nars A G 18: 64,501,320 Y511H probably damaging Het
Naxe C A 3: 88,058,152 S84I probably damaging Het
Ncam2 A T 16: 81,589,635 D634V probably damaging Het
Npat C T 9: 53,570,609 Q1206* probably null Het
Nr1d2 G A 14: 18,215,409 T201I probably benign Het
Nup155 C T 15: 8,112,420 H99Y probably damaging Het
Olfr1130 G T 2: 87,607,524 L45F probably benign Het
Olfr1289 G A 2: 111,483,495 V50I possibly damaging Het
Olfr209 A G 16: 59,361,627 V197A possibly damaging Het
Olfr826 A G 10: 130,180,223 V219A possibly damaging Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Pde6a T A 18: 61,232,844 Y214N probably damaging Het
Pex7 T C 10: 19,894,328 T145A probably damaging Het
Plekhj1 C T 10: 80,796,470 S146N probably benign Het
Ralgapb C T 2: 158,426,297 P107S probably damaging Het
Satb1 A G 17: 51,767,950 M506T probably damaging Het
Sh3gl1 T C 17: 56,018,821 N203D possibly damaging Het
Slc7a12 A T 3: 14,497,282 I240F probably benign Het
Syt17 T A 7: 118,434,341 Y144F probably benign Het
Thbd G T 2: 148,407,537 T137K possibly damaging Het
Tmem114 A G 16: 8,412,167 F124L probably damaging Het
Ubtd1 G T 19: 42,032,117 probably null Het
Zfp458 A G 13: 67,258,088 Y96H possibly damaging Het
Zfp78 T C 7: 6,378,493 S181P probably benign Het
Other mutations in Mfsd2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Mfsd2b APN 12 4866469 missense possibly damaging 0.63
IGL03188:Mfsd2b APN 12 4866538 splice site probably null
IGL03339:Mfsd2b APN 12 4874335 start codon destroyed probably null
R0142:Mfsd2b UTSW 12 4866234 missense probably benign 0.11
R1468:Mfsd2b UTSW 12 4870536 nonsense probably null
R1468:Mfsd2b UTSW 12 4870536 nonsense probably null
R1535:Mfsd2b UTSW 12 4870605 missense probably damaging 1.00
R1718:Mfsd2b UTSW 12 4869037 missense probably damaging 1.00
R1894:Mfsd2b UTSW 12 4869155 missense probably damaging 0.99
R2127:Mfsd2b UTSW 12 4867659 missense probably benign 0.01
R2392:Mfsd2b UTSW 12 4865164 missense possibly damaging 0.73
R3737:Mfsd2b UTSW 12 4870578 missense probably damaging 1.00
R3738:Mfsd2b UTSW 12 4870578 missense probably damaging 1.00
R3739:Mfsd2b UTSW 12 4870578 missense probably damaging 1.00
R3956:Mfsd2b UTSW 12 4866848 missense probably damaging 1.00
R4035:Mfsd2b UTSW 12 4870578 missense probably damaging 1.00
R4244:Mfsd2b UTSW 12 4874356 utr 5 prime probably benign
R4595:Mfsd2b UTSW 12 4865807 missense possibly damaging 0.87
R4667:Mfsd2b UTSW 12 4867636 missense probably benign 0.01
R4723:Mfsd2b UTSW 12 4868992 missense probably benign 0.03
R5126:Mfsd2b UTSW 12 4866183 missense probably benign 0.30
R5145:Mfsd2b UTSW 12 4865908 unclassified probably benign
R5890:Mfsd2b UTSW 12 4867651 missense probably damaging 1.00
R5976:Mfsd2b UTSW 12 4866522 missense probably damaging 1.00
R6753:Mfsd2b UTSW 12 4867358 missense possibly damaging 0.90
R6912:Mfsd2b UTSW 12 4870611 nonsense probably null
R7182:Mfsd2b UTSW 12 4866157 critical splice donor site probably null
R7472:Mfsd2b UTSW 12 4866481 missense probably damaging 1.00
R8559:Mfsd2b UTSW 12 4871471 missense possibly damaging 0.63
R8992:Mfsd2b UTSW 12 4871490 missense probably benign
R9410:Mfsd2b UTSW 12 4865747 missense probably damaging 1.00
R9474:Mfsd2b UTSW 12 4866820 missense possibly damaging 0.91
X0062:Mfsd2b UTSW 12 4865170 missense probably benign 0.01
Z1176:Mfsd2b UTSW 12 4866530 critical splice acceptor site probably null
Z1177:Mfsd2b UTSW 12 4865794 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGACAGACCTGTGAGCTGAC -3'
(R):5'- TTTAATCTCATTCCAGCCGAGGG -3'

Sequencing Primer
(F):5'- TGAGCTGACCCCTCACTG -3'
(R):5'- TTGGGGGCTAGGCTCAAAG -3'
Posted On 2020-10-20