Incidental Mutation 'R8429:Nt5el'
ID 653668
Institutional Source Beutler Lab
Gene Symbol Nt5el
Ensembl Gene ENSMUSG00000021718
Gene Name 5' nucleotidase, ecto-like
Synonyms 4933425L06Rik
MMRRC Submission 067774-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8429 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 105218630-105258290 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105255296 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 459 (Y459C)
Ref Sequence ENSEMBL: ENSMUSP00000022232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022232]
AlphaFold Q9D3Z8
Predicted Effect probably damaging
Transcript: ENSMUST00000022232
AA Change: Y459C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022232
Gene: ENSMUSG00000021718
AA Change: Y459C

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:Metallophos 40 245 4.8e-12 PFAM
Pfam:5_nucleotid_C 314 472 4.1e-42 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A T 17: 48,347,875 (GRCm39) L143* probably null Het
2900026A02Rik T C 5: 113,331,302 (GRCm39) T971A probably benign Het
Abca6 A T 11: 110,093,208 (GRCm39) C1022S probably benign Het
Adgrf4 G T 17: 42,978,340 (GRCm39) N334K probably benign Het
Baz1b A G 5: 135,246,185 (GRCm39) K545E probably benign Het
Bin3 A G 14: 70,374,598 (GRCm39) Y209C probably damaging Het
Btbd16 G A 7: 130,397,067 (GRCm39) A223T probably benign Het
C3 A G 17: 57,529,811 (GRCm39) V555A probably damaging Het
Calm3 T A 7: 16,653,592 (GRCm39) probably null Het
Cct4 T A 11: 22,946,030 (GRCm39) L124Q probably damaging Het
Cenpf C T 1: 189,389,504 (GRCm39) D1443N possibly damaging Het
Egfem1 G A 3: 29,711,417 (GRCm39) probably null Het
Epha4 G T 1: 77,366,673 (GRCm39) Q591K probably benign Het
Fanci T C 7: 79,088,133 (GRCm39) F929L possibly damaging Het
Fnip1 A T 11: 54,366,522 (GRCm39) D95V possibly damaging Het
Foxc1 A T 13: 31,991,759 (GRCm39) H190L probably benign Het
Gm45713 T C 7: 44,785,540 (GRCm39) S2G unknown Het
Grin2b T C 6: 135,710,914 (GRCm39) I877M probably damaging Het
Hadha T C 5: 30,349,255 (GRCm39) I119V probably benign Het
Hcar2 C T 5: 124,003,538 (GRCm39) probably benign Het
Irag2 C A 6: 145,110,949 (GRCm39) D251E probably damaging Het
Krt13 A T 11: 100,011,951 (GRCm39) L124Q probably damaging Het
Larp1b A G 3: 40,931,662 (GRCm39) *336W probably null Het
Man2c1 T C 9: 57,038,445 (GRCm39) L35P probably damaging Het
Meioc A T 11: 102,565,032 (GRCm39) N160I probably benign Het
Mfsd2b G T 12: 4,916,487 (GRCm39) Q331K possibly damaging Het
Mical2 T A 7: 111,944,460 (GRCm39) V930E probably benign Het
Mrgprb4 A T 7: 47,848,173 (GRCm39) F252I probably benign Het
Nars1 A G 18: 64,634,391 (GRCm39) Y511H probably damaging Het
Naxe C A 3: 87,965,459 (GRCm39) S84I probably damaging Het
Ncam2 A T 16: 81,386,523 (GRCm39) D634V probably damaging Het
Npat C T 9: 53,481,909 (GRCm39) Q1206* probably null Het
Nr1d2 G A 14: 18,215,409 (GRCm38) T201I probably benign Het
Nup155 C T 15: 8,141,904 (GRCm39) H99Y probably damaging Het
Or10ag60 G T 2: 87,437,868 (GRCm39) L45F probably benign Het
Or4f4b G A 2: 111,313,840 (GRCm39) V50I possibly damaging Het
Or5ac25 A G 16: 59,181,990 (GRCm39) V197A possibly damaging Het
Or9k2b A G 10: 130,016,092 (GRCm39) V219A possibly damaging Het
Pcnx3 C T 19: 5,715,412 (GRCm39) G1946E probably damaging Het
Pde6a T A 18: 61,365,916 (GRCm39) Y214N probably damaging Het
Pex7 T C 10: 19,770,074 (GRCm39) T145A probably damaging Het
Plekhj1 C T 10: 80,632,304 (GRCm39) S146N probably benign Het
Ralgapb C T 2: 158,268,217 (GRCm39) P107S probably damaging Het
Satb1 A G 17: 52,074,978 (GRCm39) M506T probably damaging Het
Sh3gl1 T C 17: 56,325,821 (GRCm39) N203D possibly damaging Het
Slc7a12 A T 3: 14,562,342 (GRCm39) I240F probably benign Het
Spata31h1 G T 10: 82,125,301 (GRCm39) Q2570K possibly damaging Het
Syt17 T A 7: 118,033,564 (GRCm39) Y144F probably benign Het
Thbd G T 2: 148,249,457 (GRCm39) T137K possibly damaging Het
Tmem114 A G 16: 8,230,031 (GRCm39) F124L probably damaging Het
Ubtd1 G T 19: 42,020,556 (GRCm39) probably null Het
Zfp458 A G 13: 67,406,152 (GRCm39) Y96H possibly damaging Het
Zfp78 T C 7: 6,381,492 (GRCm39) S181P probably benign Het
Other mutations in Nt5el
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00862:Nt5el APN 13 105,255,192 (GRCm39) missense probably damaging 1.00
IGL01099:Nt5el APN 13 105,245,868 (GRCm39) missense probably benign 0.00
IGL01540:Nt5el APN 13 105,218,761 (GRCm39) missense possibly damaging 0.47
IGL01968:Nt5el APN 13 105,256,338 (GRCm39) missense probably damaging 0.98
IGL02364:Nt5el APN 13 105,218,808 (GRCm39) missense probably damaging 1.00
IGL02447:Nt5el APN 13 105,236,967 (GRCm39) missense probably damaging 0.99
R0534:Nt5el UTSW 13 105,218,762 (GRCm39) nonsense probably null
R1486:Nt5el UTSW 13 105,246,291 (GRCm39) missense probably benign 0.26
R1543:Nt5el UTSW 13 105,248,877 (GRCm39) nonsense probably null
R1544:Nt5el UTSW 13 105,246,129 (GRCm39) missense probably benign 0.00
R1631:Nt5el UTSW 13 105,218,749 (GRCm39) missense probably benign
R1807:Nt5el UTSW 13 105,218,744 (GRCm39) missense probably benign
R1835:Nt5el UTSW 13 105,218,702 (GRCm39) missense unknown
R2427:Nt5el UTSW 13 105,246,269 (GRCm39) missense probably benign 0.03
R2504:Nt5el UTSW 13 105,246,250 (GRCm39) missense probably benign 0.09
R4353:Nt5el UTSW 13 105,255,253 (GRCm39) missense probably benign 0.14
R4949:Nt5el UTSW 13 105,246,214 (GRCm39) missense probably damaging 1.00
R6242:Nt5el UTSW 13 105,246,048 (GRCm39) missense probably benign 0.00
R6376:Nt5el UTSW 13 105,256,473 (GRCm39) missense possibly damaging 0.95
R6615:Nt5el UTSW 13 105,248,993 (GRCm39) missense probably damaging 1.00
R7610:Nt5el UTSW 13 105,247,695 (GRCm39) missense probably damaging 1.00
R7773:Nt5el UTSW 13 105,218,793 (GRCm39) missense probably damaging 1.00
R7985:Nt5el UTSW 13 105,256,482 (GRCm39) missense probably benign 0.22
R8171:Nt5el UTSW 13 105,246,291 (GRCm39) missense probably benign 0.26
R9339:Nt5el UTSW 13 105,246,114 (GRCm39) missense probably benign 0.00
R9497:Nt5el UTSW 13 105,236,987 (GRCm39) missense probably damaging 0.97
X0024:Nt5el UTSW 13 105,249,019 (GRCm39) missense probably damaging 0.99
X0057:Nt5el UTSW 13 105,218,759 (GRCm39) missense probably benign
Z1176:Nt5el UTSW 13 105,247,652 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCTGATTAGTGTGGTGCAGAAC -3'
(R):5'- ATGCATGGACTTTAGAGGGCC -3'

Sequencing Primer
(F):5'- ACTGTGTGAGAAGAAGTCGTTTTTAC -3'
(R):5'- AGAGGGCCTGTACTTTTACATC -3'
Posted On 2020-10-20