Incidental Mutation 'R8429:Nr1d2'
ID 653669
Institutional Source Beutler Lab
Gene Symbol Nr1d2
Ensembl Gene ENSMUSG00000021775
Gene Name nuclear receptor subfamily 1, group D, member 2
Synonyms Rev-erb beta, RVR
MMRRC Submission 067774-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8429 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 4230569-4265642 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 18215409 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 201 (T201I)
Ref Sequence ENSEMBL: ENSMUSP00000088031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090543] [ENSMUST00000225491]
AlphaFold Q60674
Predicted Effect probably benign
Transcript: ENSMUST00000090543
AA Change: T201I

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000088031
Gene: ENSMUSG00000021775
AA Change: T201I

DomainStartEndE-ValueType
low complexity region 13 47 N/A INTRINSIC
ZnF_C4 100 172 4.2e-38 SMART
Blast:HOLI 185 241 2e-13 BLAST
HOLI 404 562 3.71e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225491
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the nuclear hormone receptor family, specifically the NR1 subfamily of receptors. The encoded protein functions as a transcriptional repressor and may play a role in circadian rhythms and carbohydrate and lipid metabolism. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no gross abnormalities. Mice homozygous for a different knock-out allele display an increased anxiety-related response. A subset of mice homozygous for a third knock-out allele show neonatal lethality, atrioventricular septal defects (AVSDs) and related cardiovascular malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A T 17: 48,347,875 (GRCm39) L143* probably null Het
2900026A02Rik T C 5: 113,331,302 (GRCm39) T971A probably benign Het
Abca6 A T 11: 110,093,208 (GRCm39) C1022S probably benign Het
Adgrf4 G T 17: 42,978,340 (GRCm39) N334K probably benign Het
Baz1b A G 5: 135,246,185 (GRCm39) K545E probably benign Het
Bin3 A G 14: 70,374,598 (GRCm39) Y209C probably damaging Het
Btbd16 G A 7: 130,397,067 (GRCm39) A223T probably benign Het
C3 A G 17: 57,529,811 (GRCm39) V555A probably damaging Het
Calm3 T A 7: 16,653,592 (GRCm39) probably null Het
Cct4 T A 11: 22,946,030 (GRCm39) L124Q probably damaging Het
Cenpf C T 1: 189,389,504 (GRCm39) D1443N possibly damaging Het
Egfem1 G A 3: 29,711,417 (GRCm39) probably null Het
Epha4 G T 1: 77,366,673 (GRCm39) Q591K probably benign Het
Fanci T C 7: 79,088,133 (GRCm39) F929L possibly damaging Het
Fnip1 A T 11: 54,366,522 (GRCm39) D95V possibly damaging Het
Foxc1 A T 13: 31,991,759 (GRCm39) H190L probably benign Het
Gm45713 T C 7: 44,785,540 (GRCm39) S2G unknown Het
Grin2b T C 6: 135,710,914 (GRCm39) I877M probably damaging Het
Hadha T C 5: 30,349,255 (GRCm39) I119V probably benign Het
Hcar2 C T 5: 124,003,538 (GRCm39) probably benign Het
Irag2 C A 6: 145,110,949 (GRCm39) D251E probably damaging Het
Krt13 A T 11: 100,011,951 (GRCm39) L124Q probably damaging Het
Larp1b A G 3: 40,931,662 (GRCm39) *336W probably null Het
Man2c1 T C 9: 57,038,445 (GRCm39) L35P probably damaging Het
Meioc A T 11: 102,565,032 (GRCm39) N160I probably benign Het
Mfsd2b G T 12: 4,916,487 (GRCm39) Q331K possibly damaging Het
Mical2 T A 7: 111,944,460 (GRCm39) V930E probably benign Het
Mrgprb4 A T 7: 47,848,173 (GRCm39) F252I probably benign Het
Nars1 A G 18: 64,634,391 (GRCm39) Y511H probably damaging Het
Naxe C A 3: 87,965,459 (GRCm39) S84I probably damaging Het
Ncam2 A T 16: 81,386,523 (GRCm39) D634V probably damaging Het
Npat C T 9: 53,481,909 (GRCm39) Q1206* probably null Het
Nt5el A G 13: 105,255,296 (GRCm39) Y459C probably damaging Het
Nup155 C T 15: 8,141,904 (GRCm39) H99Y probably damaging Het
Or10ag60 G T 2: 87,437,868 (GRCm39) L45F probably benign Het
Or4f4b G A 2: 111,313,840 (GRCm39) V50I possibly damaging Het
Or5ac25 A G 16: 59,181,990 (GRCm39) V197A possibly damaging Het
Or9k2b A G 10: 130,016,092 (GRCm39) V219A possibly damaging Het
Pcnx3 C T 19: 5,715,412 (GRCm39) G1946E probably damaging Het
Pde6a T A 18: 61,365,916 (GRCm39) Y214N probably damaging Het
Pex7 T C 10: 19,770,074 (GRCm39) T145A probably damaging Het
Plekhj1 C T 10: 80,632,304 (GRCm39) S146N probably benign Het
Ralgapb C T 2: 158,268,217 (GRCm39) P107S probably damaging Het
Satb1 A G 17: 52,074,978 (GRCm39) M506T probably damaging Het
Sh3gl1 T C 17: 56,325,821 (GRCm39) N203D possibly damaging Het
Slc7a12 A T 3: 14,562,342 (GRCm39) I240F probably benign Het
Spata31h1 G T 10: 82,125,301 (GRCm39) Q2570K possibly damaging Het
Syt17 T A 7: 118,033,564 (GRCm39) Y144F probably benign Het
Thbd G T 2: 148,249,457 (GRCm39) T137K possibly damaging Het
Tmem114 A G 16: 8,230,031 (GRCm39) F124L probably damaging Het
Ubtd1 G T 19: 42,020,556 (GRCm39) probably null Het
Zfp458 A G 13: 67,406,152 (GRCm39) Y96H possibly damaging Het
Zfp78 T C 7: 6,381,492 (GRCm39) S181P probably benign Het
Other mutations in Nr1d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Nr1d2 APN 14 18,215,502 (GRCm38) intron probably benign
IGL00897:Nr1d2 APN 14 18,214,993 (GRCm38) missense probably benign 0.03
IGL02425:Nr1d2 APN 14 18,222,011 (GRCm38) missense probably benign
IGL03039:Nr1d2 APN 14 18,215,184 (GRCm38) missense probably benign 0.01
IGL03169:Nr1d2 APN 14 18,216,703 (GRCm38) missense probably damaging 1.00
IGL03388:Nr1d2 APN 14 18,215,403 (GRCm38) missense probably benign 0.02
R0173:Nr1d2 UTSW 14 18,215,502 (GRCm38) intron probably benign
R0242:Nr1d2 UTSW 14 18,211,933 (GRCm38) missense possibly damaging 0.80
R0242:Nr1d2 UTSW 14 18,211,933 (GRCm38) missense possibly damaging 0.80
R0674:Nr1d2 UTSW 14 18,215,086 (GRCm38) missense probably benign 0.00
R1240:Nr1d2 UTSW 14 18,211,891 (GRCm38) missense probably benign 0.04
R3115:Nr1d2 UTSW 14 18,215,504 (GRCm38) splice site probably null
R3738:Nr1d2 UTSW 14 18,211,804 (GRCm38) missense possibly damaging 0.74
R4165:Nr1d2 UTSW 14 18,215,446 (GRCm38) missense probably benign 0.05
R5319:Nr1d2 UTSW 14 18,215,197 (GRCm38) missense probably benign 0.00
R5353:Nr1d2 UTSW 14 18,222,125 (GRCm38) missense probably benign 0.05
R5384:Nr1d2 UTSW 14 18,211,922 (GRCm38) missense probably benign 0.08
R5486:Nr1d2 UTSW 14 18,206,860 (GRCm38) missense possibly damaging 0.65
R5827:Nr1d2 UTSW 14 18,222,248 (GRCm38) missense possibly damaging 0.88
R7873:Nr1d2 UTSW 14 18,216,656 (GRCm38) nonsense probably null
R8268:Nr1d2 UTSW 14 18,216,659 (GRCm38) missense probably damaging 1.00
R8411:Nr1d2 UTSW 14 18,215,031 (GRCm38) missense probably damaging 0.98
R8696:Nr1d2 UTSW 14 18,216,661 (GRCm38) missense probably damaging 1.00
R8912:Nr1d2 UTSW 14 18,220,030 (GRCm38) missense probably damaging 1.00
X0067:Nr1d2 UTSW 14 18,211,823 (GRCm38) missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- GGCATGCTCTCAGATGAGTTTTC -3'
(R):5'- CCAAGGGTTTCAGAGCTAGTTTTG -3'

Sequencing Primer
(F):5'- ATACAGAAAGGTATCCTTGTGGGCTC -3'
(R):5'- GTGTCATTGTTTTATGTAAGCAGAGC -3'
Posted On 2020-10-20