Incidental Mutation 'R8429:Nup155'
ID653671
Institutional Source Beutler Lab
Gene Symbol Nup155
Ensembl Gene ENSMUSG00000022142
Gene Namenucleoporin 155
SynonymsD930027M19Rik
MMRRC Submission
Accession Numbers

Genbank: NM_133227

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8429 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location8109273-8161247 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 8112420 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 99 (H99Y)
Ref Sequence ENSEMBL: ENSMUSP00000128819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163765] [ENSMUST00000230017]
Predicted Effect probably damaging
Transcript: ENSMUST00000163765
AA Change: H99Y

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128819
Gene: ENSMUSG00000022142
AA Change: H99Y

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
Pfam:Nucleoporin_N 77 510 3.5e-105 PFAM
low complexity region 600 619 N/A INTRINSIC
Pfam:Nucleoporin_C 678 1221 3.6e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000230017
AA Change: H99Y

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleoporins are proteins that play an important role in the assembly and functioning of the nuclear pore complex (NPC) which regulates the movement of macromolecules across the nuclear envelope (NE). The protein encoded by this gene plays a role in the fusion of NE vesicles and formation of the double membrane NE. The protein may also be involved in cardiac physiology and may be associated with the pathogenesis of atrial fibrillation. Alternative splicing results in multiple transcript variants of this gene. A pseudogene associated with this gene is located on chromosome 6. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to E8.5. Mice homozygous for a gene trap allele exhibit atria fibrillation associated with shortened action potential duration. [provided by MGI curators]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A T 17: 48,037,066 L143* probably null Het
2900026A02Rik T C 5: 113,183,436 T971A probably benign Het
4932415D10Rik G T 10: 82,289,467 Q2570K possibly damaging Het
4933425L06Rik A G 13: 105,118,788 Y459C probably damaging Het
Abca6 A T 11: 110,202,382 C1022S probably benign Het
Adgrf4 G T 17: 42,667,449 N334K probably benign Het
Baz1b A G 5: 135,217,331 K545E probably benign Het
Bin3 A G 14: 70,137,149 Y209C probably damaging Het
Btbd16 G A 7: 130,795,337 A223T probably benign Het
C3 A G 17: 57,222,811 V555A probably damaging Het
Calm3 T A 7: 16,919,667 probably null Het
Cct4 T A 11: 22,996,030 L124Q probably damaging Het
Cenpf C T 1: 189,657,307 D1443N possibly damaging Het
Egfem1 G A 3: 29,657,268 probably null Het
Epha4 G T 1: 77,390,036 Q591K probably benign Het
Fanci T C 7: 79,438,385 F929L possibly damaging Het
Fnip1 A T 11: 54,475,696 D95V possibly damaging Het
Foxc1 A T 13: 31,807,776 H190L probably benign Het
Gm45713 T C 7: 45,136,116 S2G unknown Het
Grin2b T C 6: 135,733,916 I877M probably damaging Het
Hadha T C 5: 30,144,257 I119V probably benign Het
Hcar2 C T 5: 123,865,475 probably benign Het
Krt13 A T 11: 100,121,125 L124Q probably damaging Het
Larp1b A G 3: 40,977,227 *336W probably null Het
Lrmp C A 6: 145,165,223 D251E probably damaging Het
Man2c1 T C 9: 57,131,161 L35P probably damaging Het
Meioc A T 11: 102,674,206 N160I probably benign Het
Mfsd2b G T 12: 4,866,487 Q331K possibly damaging Het
Mical2 T A 7: 112,345,253 V930E probably benign Het
Mrgprb4 A T 7: 48,198,425 F252I probably benign Het
Nars A G 18: 64,501,320 Y511H probably damaging Het
Naxe C A 3: 88,058,152 S84I probably damaging Het
Ncam2 A T 16: 81,589,635 D634V probably damaging Het
Npat C T 9: 53,570,609 Q1206* probably null Het
Nr1d2 G A 14: 18,215,409 T201I probably benign Het
Olfr1130 G T 2: 87,607,524 L45F probably benign Het
Olfr1289 G A 2: 111,483,495 V50I possibly damaging Het
Olfr209 A G 16: 59,361,627 V197A possibly damaging Het
Olfr826 A G 10: 130,180,223 V219A possibly damaging Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Pde6a T A 18: 61,232,844 Y214N probably damaging Het
Pex7 T C 10: 19,894,328 T145A probably damaging Het
Plekhj1 C T 10: 80,796,470 S146N probably benign Het
Ralgapb C T 2: 158,426,297 P107S probably damaging Het
Satb1 A G 17: 51,767,950 M506T probably damaging Het
Sh3gl1 T C 17: 56,018,821 N203D possibly damaging Het
Slc7a12 A T 3: 14,497,282 I240F probably benign Het
Syt17 T A 7: 118,434,341 Y144F probably benign Het
Thbd G T 2: 148,407,537 T137K possibly damaging Het
Tmem114 A G 16: 8,412,167 F124L probably damaging Het
Ubtd1 G T 19: 42,032,117 probably null Het
Zfp458 A G 13: 67,258,088 Y96H possibly damaging Het
Zfp78 T C 7: 6,378,493 S181P probably benign Het
Other mutations in Nup155
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Nup155 APN 15 8121455 splice site probably benign
IGL00426:Nup155 APN 15 8156794 makesense probably null
IGL00765:Nup155 APN 15 8153228 missense probably benign 0.16
IGL00936:Nup155 APN 15 8128405 splice site probably benign
IGL01124:Nup155 APN 15 8153679 missense probably damaging 0.97
IGL01739:Nup155 APN 15 8135788 missense probably benign 0.01
IGL02013:Nup155 APN 15 8113648 missense possibly damaging 0.61
IGL02066:Nup155 APN 15 8157766 unclassified probably benign
IGL02231:Nup155 APN 15 8144064 missense probably damaging 1.00
IGL02246:Nup155 APN 15 8143002 missense probably benign
IGL02289:Nup155 APN 15 8131493 missense probably damaging 1.00
IGL02608:Nup155 APN 15 8109471 missense probably benign
IGL02749:Nup155 APN 15 8134076 missense probably damaging 1.00
IGL02813:Nup155 APN 15 8130121 splice site probably benign
IGL03102:Nup155 APN 15 8147284 missense probably benign 0.00
H8930:Nup155 UTSW 15 8157658 missense possibly damaging 0.50
IGL02835:Nup155 UTSW 15 8143130 missense probably damaging 1.00
R0314:Nup155 UTSW 15 8147252 missense probably benign 0.00
R0365:Nup155 UTSW 15 8131543 missense probably damaging 1.00
R0586:Nup155 UTSW 15 8130232 missense probably benign 0.39
R0764:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R0839:Nup155 UTSW 15 8145587 missense possibly damaging 0.48
R0844:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1066:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1067:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1085:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1137:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1162:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1166:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1202:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1203:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1219:Nup155 UTSW 15 8117338 missense possibly damaging 0.80
R1385:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1421:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1448:Nup155 UTSW 15 8112406 missense probably benign 0.44
R1611:Nup155 UTSW 15 8130160 missense probably damaging 1.00
R1836:Nup155 UTSW 15 8154980 missense possibly damaging 0.79
R1863:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1866:Nup155 UTSW 15 8115526 missense probably damaging 1.00
R1894:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1976:Nup155 UTSW 15 8135827 missense probably benign 0.01
R2024:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R2026:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R2027:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R2077:Nup155 UTSW 15 8143026 missense probably damaging 1.00
R2111:Nup155 UTSW 15 8121467 missense probably benign 0.45
R2921:Nup155 UTSW 15 8153641 missense probably damaging 1.00
R2936:Nup155 UTSW 15 8143049 missense possibly damaging 0.89
R3108:Nup155 UTSW 15 8117306 missense probably null 1.00
R3161:Nup155 UTSW 15 8148383 missense possibly damaging 0.56
R3162:Nup155 UTSW 15 8148383 missense possibly damaging 0.56
R3162:Nup155 UTSW 15 8148383 missense possibly damaging 0.56
R3522:Nup155 UTSW 15 8156678 splice site probably benign
R4423:Nup155 UTSW 15 8121464 missense probably damaging 0.99
R4451:Nup155 UTSW 15 8150882 missense probably benign 0.02
R4498:Nup155 UTSW 15 8153673 missense possibly damaging 0.88
R4780:Nup155 UTSW 15 8157703 missense probably benign 0.00
R4822:Nup155 UTSW 15 8128526 missense possibly damaging 0.49
R5013:Nup155 UTSW 15 8124238 missense probably benign 0.00
R5064:Nup155 UTSW 15 8135870 missense probably damaging 1.00
R5172:Nup155 UTSW 15 8109542 missense probably benign 0.06
R5406:Nup155 UTSW 15 8153638 critical splice acceptor site probably null
R5551:Nup155 UTSW 15 8148333 missense probably benign 0.09
R5588:Nup155 UTSW 15 8119253 critical splice donor site probably null
R5977:Nup155 UTSW 15 8130237 critical splice donor site probably null
R6035:Nup155 UTSW 15 8144093 missense probably benign
R6035:Nup155 UTSW 15 8144093 missense probably benign
R6036:Nup155 UTSW 15 8128411 missense probably benign 0.16
R6036:Nup155 UTSW 15 8128411 missense probably benign 0.16
R6085:Nup155 UTSW 15 8148358 missense probably damaging 0.98
R6188:Nup155 UTSW 15 8109575 missense probably damaging 1.00
R6232:Nup155 UTSW 15 8109479 missense probably benign 0.02
R6257:Nup155 UTSW 15 8150798 nonsense probably null
R6262:Nup155 UTSW 15 8156741 missense probably benign 0.03
R6267:Nup155 UTSW 15 8153155 missense probably damaging 1.00
R6296:Nup155 UTSW 15 8153155 missense probably damaging 1.00
R6299:Nup155 UTSW 15 8128438 missense possibly damaging 0.88
R6303:Nup155 UTSW 15 8118042 missense probably damaging 1.00
R6304:Nup155 UTSW 15 8118042 missense probably damaging 1.00
R6763:Nup155 UTSW 15 8135895 nonsense probably null
R6958:Nup155 UTSW 15 8147154 missense probably damaging 1.00
R7088:Nup155 UTSW 15 8156693 missense probably benign 0.11
R7313:Nup155 UTSW 15 8154922 missense probably damaging 0.96
R7451:Nup155 UTSW 15 8145607 nonsense probably null
R7560:Nup155 UTSW 15 8155047 missense probably benign 0.39
R7633:Nup155 UTSW 15 8109453 missense probably damaging 0.99
R7670:Nup155 UTSW 15 8153696 missense probably damaging 0.99
R7726:Nup155 UTSW 15 8122139 missense probably damaging 1.00
R7752:Nup155 UTSW 15 8116442 missense possibly damaging 0.53
R7889:Nup155 UTSW 15 8121507 missense probably damaging 0.98
R7899:Nup155 UTSW 15 8119179 missense probably damaging 1.00
R7901:Nup155 UTSW 15 8116442 missense possibly damaging 0.53
R8507:Nup155 UTSW 15 8147560 nonsense probably null
RF003:Nup155 UTSW 15 8119176 critical splice acceptor site probably benign
RF048:Nup155 UTSW 15 8119176 critical splice acceptor site probably benign
Z1177:Nup155 UTSW 15 8120489 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TCTATTCCTAGTTGATGAGTGGTAC -3'
(R):5'- TCAGGCATGCCAGACAAATG -3'

Sequencing Primer
(F):5'- CCTAGTTGATGAGTGGTACTTTATTG -3'
(R):5'- GACAAATGAGCTATACATGTGGCTC -3'
Posted On2020-10-20