Mutagenetix > Incidental Mutation

Incidental Mutation 'R8429:Ncam2'

653674

Institutional Source

Beutler Lab

Gene Symbol

Ncam2

Ensembl Gene

ENSMUSG00000022762

Gene Name

neural cell adhesion molecule 2

Synonyms

Ocam, RNCAM, Ncam-2, R4B12 antigen

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8429 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

81200697-81626828 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 81589635 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 634 (D634V)

Ref Sequence

ENSEMBL: ENSMUSP00000063468 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037785] [ENSMUST00000067602]

AlphaFold

O35136

Predicted Effect

probably benign
Transcript: ENSMUST00000037785
AA Change: D634V

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000049390
Gene: ENSMUSG00000022762
AA Change: D634V

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
IGc2	33	100	3.18e-6	SMART
IGc2	127	193	1.13e-11	SMART
IGc2	223	288	2.03e-13	SMART
IGc2	313	387	1.12e-15	SMART
IGc2	413	482	9.93e-8	SMART
FN3	496	578	5.91e-13	SMART
FN3	594	675	2.87e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000067602
AA Change: D634V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000063468
Gene: ENSMUSG00000022762
AA Change: D634V

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
IGc2	33	100	3.18e-6	SMART
IGc2	127	193	1.13e-11	SMART
IGc2	223	288	2.03e-13	SMART
IGc2	313	387	1.12e-15	SMART
IGc2	413	482	9.93e-8	SMART
FN3	496	578	5.91e-13	SMART
FN3	594	675	2.87e-2	SMART
transmembrane domain	696	718	N/A	INTRINSIC
low complexity region	741	757	N/A	INTRINSIC
low complexity region	789	812	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the immunoglobulin superfamily. It is a type I membrane protein and may function in selective fasciculation and zone-to-zone projection of the primary olfactory axons. [provided by RefSeq, Jul 2008]
PHENOTYPE: A gene trap insertion into an intron of this gene results in no obvious phenotype. Mice homozygous for a knock-out allele exhibit exhibit increased proliferation rate and clonogenic frequency in spinal cord-derived neurospheres. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700122O11Rik	A	T	17: 48,037,066	L143*	probably null	Het
2900026A02Rik	T	C	5: 113,183,436	T971A	probably benign	Het
4932415D10Rik	G	T	10: 82,289,467	Q2570K	possibly damaging	Het
4933425L06Rik	A	G	13: 105,118,788	Y459C	probably damaging	Het
Abca6	A	T	11: 110,202,382	C1022S	probably benign	Het
Adgrf4	G	T	17: 42,667,449	N334K	probably benign	Het
Baz1b	A	G	5: 135,217,331	K545E	probably benign	Het
Bin3	A	G	14: 70,137,149	Y209C	probably damaging	Het
Btbd16	G	A	7: 130,795,337	A223T	probably benign	Het
C3	A	G	17: 57,222,811	V555A	probably damaging	Het
Calm3	T	A	7: 16,919,667		probably null	Het
Cct4	T	A	11: 22,996,030	L124Q	probably damaging	Het
Cenpf	C	T	1: 189,657,307	D1443N	possibly damaging	Het
Egfem1	G	A	3: 29,657,268		probably null	Het
Epha4	G	T	1: 77,390,036	Q591K	probably benign	Het
Fanci	T	C	7: 79,438,385	F929L	possibly damaging	Het
Fnip1	A	T	11: 54,475,696	D95V	possibly damaging	Het
Foxc1	A	T	13: 31,807,776	H190L	probably benign	Het
Gm45713	T	C	7: 45,136,116	S2G	unknown	Het
Grin2b	T	C	6: 135,733,916	I877M	probably damaging	Het
Hadha	T	C	5: 30,144,257	I119V	probably benign	Het
Hcar2	C	T	5: 123,865,475		probably benign	Het
Krt13	A	T	11: 100,121,125	L124Q	probably damaging	Het
Larp1b	A	G	3: 40,977,227	*336W	probably null	Het
Lrmp	C	A	6: 145,165,223	D251E	probably damaging	Het
Man2c1	T	C	9: 57,131,161	L35P	probably damaging	Het
Meioc	A	T	11: 102,674,206	N160I	probably benign	Het
Mfsd2b	G	T	12: 4,866,487	Q331K	possibly damaging	Het
Mical2	T	A	7: 112,345,253	V930E	probably benign	Het
Mrgprb4	A	T	7: 48,198,425	F252I	probably benign	Het
Nars	A	G	18: 64,501,320	Y511H	probably damaging	Het
Naxe	C	A	3: 88,058,152	S84I	probably damaging	Het
Npat	C	T	9: 53,570,609	Q1206*	probably null	Het
Nr1d2	G	A	14: 18,215,409	T201I	probably benign	Het
Nup155	C	T	15: 8,112,420	H99Y	probably damaging	Het
Olfr1130	G	T	2: 87,607,524	L45F	probably benign	Het
Olfr1289	G	A	2: 111,483,495	V50I	possibly damaging	Het
Olfr209	A	G	16: 59,361,627	V197A	possibly damaging	Het
Olfr826	A	G	10: 130,180,223	V219A	possibly damaging	Het
Pcnx3	C	T	19: 5,665,384	G1946E	probably damaging	Het
Pde6a	T	A	18: 61,232,844	Y214N	probably damaging	Het
Pex7	T	C	10: 19,894,328	T145A	probably damaging	Het
Plekhj1	C	T	10: 80,796,470	S146N	probably benign	Het
Ralgapb	C	T	2: 158,426,297	P107S	probably damaging	Het
Satb1	A	G	17: 51,767,950	M506T	probably damaging	Het
Sh3gl1	T	C	17: 56,018,821	N203D	possibly damaging	Het
Slc7a12	A	T	3: 14,497,282	I240F	probably benign	Het
Syt17	T	A	7: 118,434,341	Y144F	probably benign	Het
Thbd	G	T	2: 148,407,537	T137K	possibly damaging	Het
Tmem114	A	G	16: 8,412,167	F124L	probably damaging	Het
Ubtd1	G	T	19: 42,032,117		probably null	Het
Zfp458	A	G	13: 67,258,088	Y96H	possibly damaging	Het
Zfp78	T	C	7: 6,378,493	S181P	probably benign	Het

Other mutations in Ncam2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01138:Ncam2	APN	16	81517579	missense	probably damaging	1.00
IGL01369:Ncam2	APN	16	81461571	missense	probably benign	0.09
IGL01554:Ncam2	APN	16	81512935	missense	possibly damaging	0.88
IGL01892:Ncam2	APN	16	81589699	missense	possibly damaging	0.71
IGL02320:Ncam2	APN	16	81434837	missense	probably damaging	0.99
IGL02669:Ncam2	APN	16	81517541	missense	probably benign	0.18
IGL03073:Ncam2	APN	16	81621347	missense	possibly damaging	0.70
IGL03353:Ncam2	APN	16	81434900	missense	probably benign	0.04
BB009:Ncam2	UTSW	16	81615820	missense	probably damaging	0.99
BB019:Ncam2	UTSW	16	81615820	missense	probably damaging	0.99
R0087:Ncam2	UTSW	16	81434901	missense	probably benign	0.11
R0097:Ncam2	UTSW	16	81517537	missense	probably damaging	1.00
R0276:Ncam2	UTSW	16	81517629	splice site	probably benign
R0279:Ncam2	UTSW	16	81623337	splice site	probably benign
R0471:Ncam2	UTSW	16	81200884	start gained	probably benign
R0523:Ncam2	UTSW	16	81461643	missense	probably damaging	0.99
R1353:Ncam2	UTSW	16	81200915	start codon destroyed	probably null
R1646:Ncam2	UTSW	16	81465706	critical splice donor site	probably benign
R1884:Ncam2	UTSW	16	81437683	missense	probably damaging	1.00
R2002:Ncam2	UTSW	16	81589698	missense	possibly damaging	0.70
R2157:Ncam2	UTSW	16	81490389	missense	probably damaging	1.00
R2330:Ncam2	UTSW	16	81512921	missense	probably benign	0.17
R2404:Ncam2	UTSW	16	81490240	splice site	probably benign
R2434:Ncam2	UTSW	16	81595225	missense	probably benign	0.01
R3104:Ncam2	UTSW	16	81465710	splice site	probably benign
R3842:Ncam2	UTSW	16	81434810	missense	probably damaging	1.00
R3954:Ncam2	UTSW	16	81589724	missense	probably damaging	1.00
R4039:Ncam2	UTSW	16	81490323	missense	probably benign	0.02
R4210:Ncam2	UTSW	16	81527103	missense	probably benign	0.02
R4514:Ncam2	UTSW	16	81512996	missense	probably benign	0.13
R4583:Ncam2	UTSW	16	81517557	missense	probably damaging	1.00
R4586:Ncam2	UTSW	16	81465569	missense	probably benign	0.06
R4710:Ncam2	UTSW	16	81465706	critical splice donor site	probably null
R4732:Ncam2	UTSW	16	81434884	missense	possibly damaging	0.63
R4733:Ncam2	UTSW	16	81434884	missense	possibly damaging	0.63
R4876:Ncam2	UTSW	16	81490346	missense	probably benign	0.27
R4923:Ncam2	UTSW	16	81589791	missense	possibly damaging	0.48
R5131:Ncam2	UTSW	16	81437662	missense	probably benign	0.44
R5329:Ncam2	UTSW	16	81434819	missense	probably damaging	1.00
R5478:Ncam2	UTSW	16	81434878	nonsense	probably null
R5479:Ncam2	UTSW	16	81434878	nonsense	probably null
R5481:Ncam2	UTSW	16	81434878	nonsense	probably null
R5519:Ncam2	UTSW	16	81434878	nonsense	probably null
R5522:Ncam2	UTSW	16	81434878	nonsense	probably null
R5523:Ncam2	UTSW	16	81434878	nonsense	probably null
R5524:Ncam2	UTSW	16	81434878	nonsense	probably null
R5526:Ncam2	UTSW	16	81434878	nonsense	probably null
R5718:Ncam2	UTSW	16	81589814	splice site	probably null
R5793:Ncam2	UTSW	16	81576103	missense	possibly damaging	0.95
R6050:Ncam2	UTSW	16	81443166	nonsense	probably null
R6212:Ncam2	UTSW	16	81432762	missense	probably damaging	1.00
R6847:Ncam2	UTSW	16	81432718	missense	probably damaging	1.00
R6935:Ncam2	UTSW	16	81526991	missense	probably benign	0.24
R7159:Ncam2	UTSW	16	81490374	missense	probably damaging	1.00
R7193:Ncam2	UTSW	16	81589795	missense	probably damaging	1.00
R7232:Ncam2	UTSW	16	81512871	missense	probably damaging	1.00
R7346:Ncam2	UTSW	16	81623368	missense	probably damaging	1.00
R7568:Ncam2	UTSW	16	81589801	missense	probably benign	0.19
R7686:Ncam2	UTSW	16	81621454	missense	probably damaging	0.99
R7759:Ncam2	UTSW	16	81615784	missense	probably damaging	1.00
R7848:Ncam2	UTSW	16	81490379	missense	probably benign
R7932:Ncam2	UTSW	16	81615820	missense	probably damaging	0.99
R8078:Ncam2	UTSW	16	81443248	missense	possibly damaging	0.60
R8287:Ncam2	UTSW	16	81526995	missense	probably benign	0.07
R8354:Ncam2	UTSW	16	81512959	missense	probably benign	0.00
R8507:Ncam2	UTSW	16	81512979	missense	possibly damaging	0.63
R8546:Ncam2	UTSW	16	81517531	missense	probably benign	0.21
R8775:Ncam2	UTSW	16	81517541	missense	probably benign	0.18
R8775-TAIL:Ncam2	UTSW	16	81517541	missense	probably benign	0.18
R9082:Ncam2	UTSW	16	81615772	missense	probably damaging	1.00
R9346:Ncam2	UTSW	16	81455316	missense	probably benign	0.07
R9386:Ncam2	UTSW	16	81455364	missense	probably damaging	1.00
R9498:Ncam2	UTSW	16	81512999	missense	probably benign	0.03
R9510:Ncam2	UTSW	16	81623453	makesense	probably null
R9587:Ncam2	UTSW	16	81465613	missense	probably benign	0.00
R9616:Ncam2	UTSW	16	81443254	missense	probably damaging	1.00
R9642:Ncam2	UTSW	16	81621363	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCTAGTTCATGTTTGACTATAAGGAG -3'
(R):5'- TGCTACTTTTAAGCAAGGCTAAC -3'

Sequencing Primer
(F):5'- TGCAGTAACATCAGTTTTTGGATAG -3'
(R):5'- CAAGGCTAACATCTTGCTTACC -3'

Posted On

2020-10-20