Incidental Mutation 'R8429:Pcnx3'
ID 653682
Institutional Source Beutler Lab
Gene Symbol Pcnx3
Ensembl Gene ENSMUSG00000054874
Gene Name pecanex homolog 3
Synonyms Pcnxl3
MMRRC Submission 067774-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8429 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 5714663-5738936 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 5715412 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 1946 (G1946E)
Ref Sequence ENSEMBL: ENSMUSP00000109245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068169] [ENSMUST00000071857] [ENSMUST00000080824] [ENSMUST00000113615] [ENSMUST00000164304] [ENSMUST00000169854]
AlphaFold Q8VI59
Predicted Effect probably damaging
Transcript: ENSMUST00000068169
AA Change: G1538E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000063786
Gene: ENSMUSG00000054874
AA Change: G1538E

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 370 376 N/A INTRINSIC
transmembrane domain 385 407 N/A INTRINSIC
transmembrane domain 411 428 N/A INTRINSIC
transmembrane domain 441 463 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 501 523 N/A INTRINSIC
transmembrane domain 538 560 N/A INTRINSIC
transmembrane domain 573 592 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
transmembrane domain 669 691 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
Pfam:Pecanex_C 1159 1389 7.5e-124 PFAM
low complexity region 1462 1479 N/A INTRINSIC
low complexity region 1481 1510 N/A INTRINSIC
low complexity region 1525 1538 N/A INTRINSIC
low complexity region 1558 1569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071857
SMART Domains Protein: ENSMUSP00000073618
Gene: ENSMUSG00000056917

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 529 7.2e-64 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080824
SMART Domains Protein: ENSMUSP00000079637
Gene: ENSMUSG00000056917

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113615
AA Change: G1946E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109245
Gene: ENSMUSG00000054874
AA Change: G1946E

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 438 459 N/A INTRINSIC
low complexity region 778 784 N/A INTRINSIC
transmembrane domain 793 815 N/A INTRINSIC
transmembrane domain 819 836 N/A INTRINSIC
transmembrane domain 849 871 N/A INTRINSIC
transmembrane domain 881 900 N/A INTRINSIC
transmembrane domain 909 931 N/A INTRINSIC
transmembrane domain 946 968 N/A INTRINSIC
transmembrane domain 981 1000 N/A INTRINSIC
transmembrane domain 1053 1075 N/A INTRINSIC
transmembrane domain 1077 1099 N/A INTRINSIC
low complexity region 1419 1433 N/A INTRINSIC
Pfam:Pecanex_C 1570 1796 5.9e-116 PFAM
low complexity region 1870 1887 N/A INTRINSIC
low complexity region 1889 1918 N/A INTRINSIC
low complexity region 1933 1946 N/A INTRINSIC
low complexity region 1966 1977 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133136
SMART Domains Protein: ENSMUSP00000123666
Gene: ENSMUSG00000054874

DomainStartEndE-ValueType
Pfam:Pecanex_C 1 129 7.9e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164304
SMART Domains Protein: ENSMUSP00000128208
Gene: ENSMUSG00000056917

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169854
SMART Domains Protein: ENSMUSP00000132345
Gene: ENSMUSG00000056917

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A T 17: 48,347,875 (GRCm39) L143* probably null Het
2900026A02Rik T C 5: 113,331,302 (GRCm39) T971A probably benign Het
Abca6 A T 11: 110,093,208 (GRCm39) C1022S probably benign Het
Adgrf4 G T 17: 42,978,340 (GRCm39) N334K probably benign Het
Baz1b A G 5: 135,246,185 (GRCm39) K545E probably benign Het
Bin3 A G 14: 70,374,598 (GRCm39) Y209C probably damaging Het
Btbd16 G A 7: 130,397,067 (GRCm39) A223T probably benign Het
C3 A G 17: 57,529,811 (GRCm39) V555A probably damaging Het
Calm3 T A 7: 16,653,592 (GRCm39) probably null Het
Cct4 T A 11: 22,946,030 (GRCm39) L124Q probably damaging Het
Cenpf C T 1: 189,389,504 (GRCm39) D1443N possibly damaging Het
Egfem1 G A 3: 29,711,417 (GRCm39) probably null Het
Epha4 G T 1: 77,366,673 (GRCm39) Q591K probably benign Het
Fanci T C 7: 79,088,133 (GRCm39) F929L possibly damaging Het
Fnip1 A T 11: 54,366,522 (GRCm39) D95V possibly damaging Het
Foxc1 A T 13: 31,991,759 (GRCm39) H190L probably benign Het
Gm45713 T C 7: 44,785,540 (GRCm39) S2G unknown Het
Grin2b T C 6: 135,710,914 (GRCm39) I877M probably damaging Het
Hadha T C 5: 30,349,255 (GRCm39) I119V probably benign Het
Hcar2 C T 5: 124,003,538 (GRCm39) probably benign Het
Irag2 C A 6: 145,110,949 (GRCm39) D251E probably damaging Het
Krt13 A T 11: 100,011,951 (GRCm39) L124Q probably damaging Het
Larp1b A G 3: 40,931,662 (GRCm39) *336W probably null Het
Man2c1 T C 9: 57,038,445 (GRCm39) L35P probably damaging Het
Meioc A T 11: 102,565,032 (GRCm39) N160I probably benign Het
Mfsd2b G T 12: 4,916,487 (GRCm39) Q331K possibly damaging Het
Mical2 T A 7: 111,944,460 (GRCm39) V930E probably benign Het
Mrgprb4 A T 7: 47,848,173 (GRCm39) F252I probably benign Het
Nars1 A G 18: 64,634,391 (GRCm39) Y511H probably damaging Het
Naxe C A 3: 87,965,459 (GRCm39) S84I probably damaging Het
Ncam2 A T 16: 81,386,523 (GRCm39) D634V probably damaging Het
Npat C T 9: 53,481,909 (GRCm39) Q1206* probably null Het
Nr1d2 G A 14: 18,215,409 (GRCm38) T201I probably benign Het
Nt5el A G 13: 105,255,296 (GRCm39) Y459C probably damaging Het
Nup155 C T 15: 8,141,904 (GRCm39) H99Y probably damaging Het
Or10ag60 G T 2: 87,437,868 (GRCm39) L45F probably benign Het
Or4f4b G A 2: 111,313,840 (GRCm39) V50I possibly damaging Het
Or5ac25 A G 16: 59,181,990 (GRCm39) V197A possibly damaging Het
Or9k2b A G 10: 130,016,092 (GRCm39) V219A possibly damaging Het
Pde6a T A 18: 61,365,916 (GRCm39) Y214N probably damaging Het
Pex7 T C 10: 19,770,074 (GRCm39) T145A probably damaging Het
Plekhj1 C T 10: 80,632,304 (GRCm39) S146N probably benign Het
Ralgapb C T 2: 158,268,217 (GRCm39) P107S probably damaging Het
Satb1 A G 17: 52,074,978 (GRCm39) M506T probably damaging Het
Sh3gl1 T C 17: 56,325,821 (GRCm39) N203D possibly damaging Het
Slc7a12 A T 3: 14,562,342 (GRCm39) I240F probably benign Het
Spata31h1 G T 10: 82,125,301 (GRCm39) Q2570K possibly damaging Het
Syt17 T A 7: 118,033,564 (GRCm39) Y144F probably benign Het
Thbd G T 2: 148,249,457 (GRCm39) T137K possibly damaging Het
Tmem114 A G 16: 8,230,031 (GRCm39) F124L probably damaging Het
Ubtd1 G T 19: 42,020,556 (GRCm39) probably null Het
Zfp458 A G 13: 67,406,152 (GRCm39) Y96H possibly damaging Het
Zfp78 T C 7: 6,381,492 (GRCm39) S181P probably benign Het
Other mutations in Pcnx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Pcnx3 APN 19 5,717,287 (GRCm39) unclassified probably benign
IGL01667:Pcnx3 APN 19 5,736,658 (GRCm39) missense probably benign 0.03
IGL01704:Pcnx3 APN 19 5,717,504 (GRCm39) missense probably damaging 1.00
IGL01752:Pcnx3 APN 19 5,715,365 (GRCm39) nonsense probably null
IGL01791:Pcnx3 APN 19 5,723,295 (GRCm39) missense probably benign 0.39
IGL01937:Pcnx3 APN 19 5,727,691 (GRCm39) missense probably benign
IGL01987:Pcnx3 APN 19 5,727,507 (GRCm39) missense probably damaging 1.00
IGL02073:Pcnx3 APN 19 5,729,414 (GRCm39) missense probably damaging 0.99
IGL02417:Pcnx3 APN 19 5,736,509 (GRCm39) missense possibly damaging 0.92
IGL03143:Pcnx3 APN 19 5,735,423 (GRCm39) missense probably damaging 1.00
buns UTSW 19 5,733,368 (GRCm39) start codon destroyed probably null
Pastries UTSW 19 5,733,367 (GRCm39) nonsense probably null
pie UTSW 19 5,717,186 (GRCm39) missense possibly damaging 0.81
R7096_pcnx3_526 UTSW 19 5,722,643 (GRCm39) missense probably damaging 1.00
swirls UTSW 19 5,722,543 (GRCm39) missense probably damaging 1.00
tip UTSW 19 5,733,808 (GRCm39) splice site probably benign
PIT4453001:Pcnx3 UTSW 19 5,722,784 (GRCm39) critical splice donor site probably null
R0234:Pcnx3 UTSW 19 5,722,646 (GRCm39) missense probably benign 0.12
R0234:Pcnx3 UTSW 19 5,722,646 (GRCm39) missense probably benign 0.12
R0360:Pcnx3 UTSW 19 5,715,611 (GRCm39) missense probably damaging 0.98
R0687:Pcnx3 UTSW 19 5,734,361 (GRCm39) missense probably damaging 1.00
R0718:Pcnx3 UTSW 19 5,727,756 (GRCm39) splice site probably benign
R0840:Pcnx3 UTSW 19 5,735,729 (GRCm39) splice site probably null
R0907:Pcnx3 UTSW 19 5,721,553 (GRCm39) missense possibly damaging 0.95
R1251:Pcnx3 UTSW 19 5,727,210 (GRCm39) missense probably benign 0.03
R1373:Pcnx3 UTSW 19 5,715,544 (GRCm39) missense probably damaging 0.97
R1467:Pcnx3 UTSW 19 5,724,922 (GRCm39) missense possibly damaging 0.63
R1467:Pcnx3 UTSW 19 5,724,922 (GRCm39) missense possibly damaging 0.63
R1572:Pcnx3 UTSW 19 5,735,375 (GRCm39) nonsense probably null
R1602:Pcnx3 UTSW 19 5,722,543 (GRCm39) missense probably damaging 1.00
R1628:Pcnx3 UTSW 19 5,736,093 (GRCm39) missense probably damaging 0.99
R1635:Pcnx3 UTSW 19 5,715,773 (GRCm39) missense probably benign 0.00
R1670:Pcnx3 UTSW 19 5,723,343 (GRCm39) missense probably damaging 1.00
R1889:Pcnx3 UTSW 19 5,722,684 (GRCm39) missense probably damaging 1.00
R1898:Pcnx3 UTSW 19 5,722,615 (GRCm39) missense probably damaging 1.00
R2113:Pcnx3 UTSW 19 5,721,584 (GRCm39) missense possibly damaging 0.93
R2147:Pcnx3 UTSW 19 5,717,633 (GRCm39) missense probably damaging 1.00
R2358:Pcnx3 UTSW 19 5,733,368 (GRCm39) start codon destroyed probably null
R2358:Pcnx3 UTSW 19 5,733,367 (GRCm39) nonsense probably null
R2871:Pcnx3 UTSW 19 5,733,774 (GRCm39) intron probably benign
R3699:Pcnx3 UTSW 19 5,722,493 (GRCm39) missense probably damaging 1.00
R3712:Pcnx3 UTSW 19 5,733,368 (GRCm39) start codon destroyed probably null
R3712:Pcnx3 UTSW 19 5,733,367 (GRCm39) nonsense probably null
R3798:Pcnx3 UTSW 19 5,728,696 (GRCm39) nonsense probably null
R3856:Pcnx3 UTSW 19 5,728,995 (GRCm39) missense probably benign 0.02
R3953:Pcnx3 UTSW 19 5,733,808 (GRCm39) splice site probably benign
R4613:Pcnx3 UTSW 19 5,717,247 (GRCm39) missense possibly damaging 0.51
R4781:Pcnx3 UTSW 19 5,737,158 (GRCm39) missense probably damaging 0.99
R4816:Pcnx3 UTSW 19 5,738,023 (GRCm39) critical splice donor site probably null
R5338:Pcnx3 UTSW 19 5,722,624 (GRCm39) missense probably damaging 1.00
R5770:Pcnx3 UTSW 19 5,731,607 (GRCm39) intron probably benign
R5950:Pcnx3 UTSW 19 5,717,186 (GRCm39) missense possibly damaging 0.81
R5951:Pcnx3 UTSW 19 5,721,708 (GRCm39) missense possibly damaging 0.71
R5969:Pcnx3 UTSW 19 5,735,563 (GRCm39) missense probably damaging 1.00
R6543:Pcnx3 UTSW 19 5,715,275 (GRCm39) missense probably benign 0.07
R6704:Pcnx3 UTSW 19 5,736,515 (GRCm39) missense possibly damaging 0.74
R7096:Pcnx3 UTSW 19 5,722,643 (GRCm39) missense probably damaging 1.00
R7177:Pcnx3 UTSW 19 5,737,527 (GRCm39) missense probably benign 0.01
R7308:Pcnx3 UTSW 19 5,736,175 (GRCm39) missense possibly damaging 0.52
R7387:Pcnx3 UTSW 19 5,723,364 (GRCm39) missense probably benign 0.33
R7488:Pcnx3 UTSW 19 5,717,487 (GRCm39) missense possibly damaging 0.72
R7670:Pcnx3 UTSW 19 5,727,210 (GRCm39) missense probably benign 0.03
R7831:Pcnx3 UTSW 19 5,735,989 (GRCm39) missense probably damaging 0.96
R7850:Pcnx3 UTSW 19 5,728,960 (GRCm39) missense possibly damaging 0.55
R8120:Pcnx3 UTSW 19 5,717,574 (GRCm39) missense probably benign
R8139:Pcnx3 UTSW 19 5,715,773 (GRCm39) missense probably benign 0.00
R8258:Pcnx3 UTSW 19 5,715,412 (GRCm39) missense probably damaging 1.00
R8259:Pcnx3 UTSW 19 5,715,412 (GRCm39) missense probably damaging 1.00
R8260:Pcnx3 UTSW 19 5,715,412 (GRCm39) missense probably damaging 1.00
R8261:Pcnx3 UTSW 19 5,715,412 (GRCm39) missense probably damaging 1.00
R8262:Pcnx3 UTSW 19 5,715,412 (GRCm39) missense probably damaging 1.00
R8350:Pcnx3 UTSW 19 5,723,254 (GRCm39) missense probably damaging 1.00
R8411:Pcnx3 UTSW 19 5,729,618 (GRCm39) missense possibly damaging 0.90
R8431:Pcnx3 UTSW 19 5,715,412 (GRCm39) missense probably damaging 1.00
R8443:Pcnx3 UTSW 19 5,736,670 (GRCm39) missense probably benign
R8450:Pcnx3 UTSW 19 5,723,254 (GRCm39) missense probably damaging 1.00
R8494:Pcnx3 UTSW 19 5,725,404 (GRCm39) missense probably damaging 0.99
R8790:Pcnx3 UTSW 19 5,735,206 (GRCm39) missense possibly damaging 0.71
R8939:Pcnx3 UTSW 19 5,730,347 (GRCm39) missense probably damaging 0.98
R9065:Pcnx3 UTSW 19 5,717,582 (GRCm39) missense possibly damaging 0.86
R9070:Pcnx3 UTSW 19 5,715,601 (GRCm39) missense probably benign 0.33
X0028:Pcnx3 UTSW 19 5,734,455 (GRCm39) missense probably damaging 1.00
X0053:Pcnx3 UTSW 19 5,736,650 (GRCm39) splice site probably null
Z1176:Pcnx3 UTSW 19 5,737,248 (GRCm39) critical splice acceptor site probably null
Z1177:Pcnx3 UTSW 19 5,721,654 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GAGCTGACATCAGGACTGAG -3'
(R):5'- TTTCCTACAGGCAGCAGTGAG -3'

Sequencing Primer
(F):5'- CATCAGGACTGAGGCTGAGGTC -3'
(R):5'- CCCTCAGTGGCTCTGGTGATG -3'
Posted On 2020-10-20