Mutagenetix > Incidental Mutation

Incidental Mutation 'R8429:Pcnx3'

653682

Institutional Source

Beutler Lab

Gene Symbol

Pcnx3

Ensembl Gene

ENSMUSG00000054874

Gene Name

pecanex homolog 3

Synonyms

Pcnxl3

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8429 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

5664635-5688908 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 5665384 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Glutamic Acid at position 1946 (G1946E)

Ref Sequence

ENSEMBL: ENSMUSP00000109245 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068169] [ENSMUST00000071857] [ENSMUST00000080824] [ENSMUST00000113615] [ENSMUST00000164304] [ENSMUST00000169854]

AlphaFold

Q8VI59

Predicted Effect

probably damaging
Transcript: ENSMUST00000068169
AA Change: G1538E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000063786
Gene: ENSMUSG00000054874
AA Change: G1538E

Domain	Start	End	E-Value	Type
transmembrane domain	36	53	N/A	INTRINSIC
transmembrane domain	57	79	N/A	INTRINSIC
low complexity region	99	111	N/A	INTRINSIC
low complexity region	370	376	N/A	INTRINSIC
transmembrane domain	385	407	N/A	INTRINSIC
transmembrane domain	411	428	N/A	INTRINSIC
transmembrane domain	441	463	N/A	INTRINSIC
transmembrane domain	473	492	N/A	INTRINSIC
transmembrane domain	501	523	N/A	INTRINSIC
transmembrane domain	538	560	N/A	INTRINSIC
transmembrane domain	573	592	N/A	INTRINSIC
transmembrane domain	645	667	N/A	INTRINSIC
transmembrane domain	669	691	N/A	INTRINSIC
low complexity region	1011	1025	N/A	INTRINSIC
Pfam:Pecanex_C	1159	1389	7.5e-124	PFAM
low complexity region	1462	1479	N/A	INTRINSIC
low complexity region	1481	1510	N/A	INTRINSIC
low complexity region	1525	1538	N/A	INTRINSIC
low complexity region	1558	1569	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000071857

SMART Domains

Protein: ENSMUSP00000073618
Gene: ENSMUSG00000056917

Domain	Start	End	E-Value	Type
low complexity region	59	70	N/A	INTRINSIC
low complexity region	90	103	N/A	INTRINSIC
low complexity region	164	192	N/A	INTRINSIC
low complexity region	278	292	N/A	INTRINSIC
Pfam:Rap_GAP	346	529	7.2e-64	PFAM
low complexity region	580	593	N/A	INTRINSIC
PDZ	692	758	9.51e-7	SMART
low complexity region	828	841	N/A	INTRINSIC
low complexity region	872	883	N/A	INTRINSIC
coiled coil region	969	1023	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000080824

SMART Domains

Protein: ENSMUSP00000079637
Gene: ENSMUSG00000056917

Domain	Start	End	E-Value	Type
low complexity region	59	70	N/A	INTRINSIC
low complexity region	90	103	N/A	INTRINSIC
low complexity region	164	192	N/A	INTRINSIC
low complexity region	278	292	N/A	INTRINSIC
Pfam:Rap_GAP	346	535	4.4e-60	PFAM
low complexity region	580	593	N/A	INTRINSIC
PDZ	692	758	9.51e-7	SMART
low complexity region	828	841	N/A	INTRINSIC
low complexity region	872	883	N/A	INTRINSIC
coiled coil region	969	1023	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113615
AA Change: G1946E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000109245
Gene: ENSMUSG00000054874
AA Change: G1946E

Domain	Start	End	E-Value	Type
transmembrane domain	36	53	N/A	INTRINSIC
transmembrane domain	57	79	N/A	INTRINSIC
low complexity region	99	111	N/A	INTRINSIC
low complexity region	438	459	N/A	INTRINSIC
low complexity region	778	784	N/A	INTRINSIC
transmembrane domain	793	815	N/A	INTRINSIC
transmembrane domain	819	836	N/A	INTRINSIC
transmembrane domain	849	871	N/A	INTRINSIC
transmembrane domain	881	900	N/A	INTRINSIC
transmembrane domain	909	931	N/A	INTRINSIC
transmembrane domain	946	968	N/A	INTRINSIC
transmembrane domain	981	1000	N/A	INTRINSIC
transmembrane domain	1053	1075	N/A	INTRINSIC
transmembrane domain	1077	1099	N/A	INTRINSIC
low complexity region	1419	1433	N/A	INTRINSIC
Pfam:Pecanex_C	1570	1796	5.9e-116	PFAM
low complexity region	1870	1887	N/A	INTRINSIC
low complexity region	1889	1918	N/A	INTRINSIC
low complexity region	1933	1946	N/A	INTRINSIC
low complexity region	1966	1977	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000133136

SMART Domains

Protein: ENSMUSP00000123666
Gene: ENSMUSG00000054874

Domain	Start	End	E-Value	Type
Pfam:Pecanex_C	1	129	7.9e-61	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000164304

SMART Domains

Protein: ENSMUSP00000128208
Gene: ENSMUSG00000056917

Domain	Start	End	E-Value	Type
low complexity region	59	70	N/A	INTRINSIC
low complexity region	90	103	N/A	INTRINSIC
low complexity region	164	192	N/A	INTRINSIC
low complexity region	278	292	N/A	INTRINSIC
Pfam:Rap_GAP	346	535	4.4e-60	PFAM
low complexity region	580	593	N/A	INTRINSIC
PDZ	692	758	9.51e-7	SMART
low complexity region	828	841	N/A	INTRINSIC
low complexity region	872	883	N/A	INTRINSIC
coiled coil region	969	1023	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169854

SMART Domains

Protein: ENSMUSP00000132345
Gene: ENSMUSG00000056917

Domain	Start	End	E-Value	Type
low complexity region	59	70	N/A	INTRINSIC
low complexity region	90	103	N/A	INTRINSIC
low complexity region	164	192	N/A	INTRINSIC
low complexity region	278	292	N/A	INTRINSIC
Pfam:Rap_GAP	346	535	4.4e-60	PFAM
low complexity region	580	593	N/A	INTRINSIC
PDZ	692	758	9.51e-7	SMART
low complexity region	828	841	N/A	INTRINSIC
low complexity region	872	883	N/A	INTRINSIC
coiled coil region	969	1023	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700122O11Rik	A	T	17: 48,037,066	L143*	probably null	Het
2900026A02Rik	T	C	5: 113,183,436	T971A	probably benign	Het
4932415D10Rik	G	T	10: 82,289,467	Q2570K	possibly damaging	Het
4933425L06Rik	A	G	13: 105,118,788	Y459C	probably damaging	Het
Abca6	A	T	11: 110,202,382	C1022S	probably benign	Het
Adgrf4	G	T	17: 42,667,449	N334K	probably benign	Het
Baz1b	A	G	5: 135,217,331	K545E	probably benign	Het
Bin3	A	G	14: 70,137,149	Y209C	probably damaging	Het
Btbd16	G	A	7: 130,795,337	A223T	probably benign	Het
C3	A	G	17: 57,222,811	V555A	probably damaging	Het
Calm3	T	A	7: 16,919,667		probably null	Het
Cct4	T	A	11: 22,996,030	L124Q	probably damaging	Het
Cenpf	C	T	1: 189,657,307	D1443N	possibly damaging	Het
Egfem1	G	A	3: 29,657,268		probably null	Het
Epha4	G	T	1: 77,390,036	Q591K	probably benign	Het
Fanci	T	C	7: 79,438,385	F929L	possibly damaging	Het
Fnip1	A	T	11: 54,475,696	D95V	possibly damaging	Het
Foxc1	A	T	13: 31,807,776	H190L	probably benign	Het
Gm45713	T	C	7: 45,136,116	S2G	unknown	Het
Grin2b	T	C	6: 135,733,916	I877M	probably damaging	Het
Hadha	T	C	5: 30,144,257	I119V	probably benign	Het
Hcar2	C	T	5: 123,865,475		probably benign	Het
Krt13	A	T	11: 100,121,125	L124Q	probably damaging	Het
Larp1b	A	G	3: 40,977,227	*336W	probably null	Het
Lrmp	C	A	6: 145,165,223	D251E	probably damaging	Het
Man2c1	T	C	9: 57,131,161	L35P	probably damaging	Het
Meioc	A	T	11: 102,674,206	N160I	probably benign	Het
Mfsd2b	G	T	12: 4,866,487	Q331K	possibly damaging	Het
Mical2	T	A	7: 112,345,253	V930E	probably benign	Het
Mrgprb4	A	T	7: 48,198,425	F252I	probably benign	Het
Nars	A	G	18: 64,501,320	Y511H	probably damaging	Het
Naxe	C	A	3: 88,058,152	S84I	probably damaging	Het
Ncam2	A	T	16: 81,589,635	D634V	probably damaging	Het
Npat	C	T	9: 53,570,609	Q1206*	probably null	Het
Nr1d2	G	A	14: 18,215,409	T201I	probably benign	Het
Nup155	C	T	15: 8,112,420	H99Y	probably damaging	Het
Olfr1130	G	T	2: 87,607,524	L45F	probably benign	Het
Olfr1289	G	A	2: 111,483,495	V50I	possibly damaging	Het
Olfr209	A	G	16: 59,361,627	V197A	possibly damaging	Het
Olfr826	A	G	10: 130,180,223	V219A	possibly damaging	Het
Pde6a	T	A	18: 61,232,844	Y214N	probably damaging	Het
Pex7	T	C	10: 19,894,328	T145A	probably damaging	Het
Plekhj1	C	T	10: 80,796,470	S146N	probably benign	Het
Ralgapb	C	T	2: 158,426,297	P107S	probably damaging	Het
Satb1	A	G	17: 51,767,950	M506T	probably damaging	Het
Sh3gl1	T	C	17: 56,018,821	N203D	possibly damaging	Het
Slc7a12	A	T	3: 14,497,282	I240F	probably benign	Het
Syt17	T	A	7: 118,434,341	Y144F	probably benign	Het
Thbd	G	T	2: 148,407,537	T137K	possibly damaging	Het
Tmem114	A	G	16: 8,412,167	F124L	probably damaging	Het
Ubtd1	G	T	19: 42,032,117		probably null	Het
Zfp458	A	G	13: 67,258,088	Y96H	possibly damaging	Het
Zfp78	T	C	7: 6,378,493	S181P	probably benign	Het

Other mutations in Pcnx3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01616:Pcnx3	APN	19	5667259	unclassified	probably benign
IGL01667:Pcnx3	APN	19	5686630	missense	probably benign	0.03
IGL01704:Pcnx3	APN	19	5667476	missense	probably damaging	1.00
IGL01752:Pcnx3	APN	19	5665337	nonsense	probably null
IGL01791:Pcnx3	APN	19	5673267	missense	probably benign	0.39
IGL01937:Pcnx3	APN	19	5677663	missense	probably benign
IGL01987:Pcnx3	APN	19	5677479	missense	probably damaging	1.00
IGL02073:Pcnx3	APN	19	5679386	missense	probably damaging	0.99
IGL02417:Pcnx3	APN	19	5686481	missense	possibly damaging	0.92
IGL03143:Pcnx3	APN	19	5685395	missense	probably damaging	1.00
buns	UTSW	19	5683340	start codon destroyed	probably null
Pastries	UTSW	19	5683339	nonsense	probably null
pie	UTSW	19	5667158	missense	possibly damaging	0.81
R7096_pcnx3_526	UTSW	19	5672615	missense	probably damaging	1.00
swirls	UTSW	19	5672515	missense	probably damaging	1.00
tip	UTSW	19	5683780	splice site	probably benign
PIT4453001:Pcnx3	UTSW	19	5672756	critical splice donor site	probably null
R0234:Pcnx3	UTSW	19	5672618	missense	probably benign	0.12
R0234:Pcnx3	UTSW	19	5672618	missense	probably benign	0.12
R0360:Pcnx3	UTSW	19	5665583	missense	probably damaging	0.98
R0687:Pcnx3	UTSW	19	5684333	missense	probably damaging	1.00
R0718:Pcnx3	UTSW	19	5677728	splice site	probably benign
R0840:Pcnx3	UTSW	19	5685701	splice site	probably null
R0907:Pcnx3	UTSW	19	5671525	missense	possibly damaging	0.95
R1251:Pcnx3	UTSW	19	5677182	missense	probably benign	0.03
R1373:Pcnx3	UTSW	19	5665516	missense	probably damaging	0.97
R1467:Pcnx3	UTSW	19	5674894	missense	possibly damaging	0.63
R1467:Pcnx3	UTSW	19	5674894	missense	possibly damaging	0.63
R1572:Pcnx3	UTSW	19	5685347	nonsense	probably null
R1602:Pcnx3	UTSW	19	5672515	missense	probably damaging	1.00
R1628:Pcnx3	UTSW	19	5686065	missense	probably damaging	0.99
R1635:Pcnx3	UTSW	19	5665745	missense	probably benign	0.00
R1670:Pcnx3	UTSW	19	5673315	missense	probably damaging	1.00
R1889:Pcnx3	UTSW	19	5672656	missense	probably damaging	1.00
R1898:Pcnx3	UTSW	19	5672587	missense	probably damaging	1.00
R2113:Pcnx3	UTSW	19	5671556	missense	possibly damaging	0.93
R2147:Pcnx3	UTSW	19	5667605	missense	probably damaging	1.00
R2358:Pcnx3	UTSW	19	5683339	nonsense	probably null
R2358:Pcnx3	UTSW	19	5683340	start codon destroyed	probably null
R2871:Pcnx3	UTSW	19	5683746	intron	probably benign
R3699:Pcnx3	UTSW	19	5672465	missense	probably damaging	1.00
R3712:Pcnx3	UTSW	19	5683339	nonsense	probably null
R3712:Pcnx3	UTSW	19	5683340	start codon destroyed	probably null
R3798:Pcnx3	UTSW	19	5678668	nonsense	probably null
R3856:Pcnx3	UTSW	19	5678967	missense	probably benign	0.02
R3953:Pcnx3	UTSW	19	5683780	splice site	probably benign
R4613:Pcnx3	UTSW	19	5667219	missense	possibly damaging	0.51
R4781:Pcnx3	UTSW	19	5687130	missense	probably damaging	0.99
R4816:Pcnx3	UTSW	19	5687995	critical splice donor site	probably null
R5338:Pcnx3	UTSW	19	5672596	missense	probably damaging	1.00
R5770:Pcnx3	UTSW	19	5681579	intron	probably benign
R5950:Pcnx3	UTSW	19	5667158	missense	possibly damaging	0.81
R5951:Pcnx3	UTSW	19	5671680	missense	possibly damaging	0.71
R5969:Pcnx3	UTSW	19	5685535	missense	probably damaging	1.00
R6543:Pcnx3	UTSW	19	5665247	missense	probably benign	0.07
R6704:Pcnx3	UTSW	19	5686487	missense	possibly damaging	0.74
R7096:Pcnx3	UTSW	19	5672615	missense	probably damaging	1.00
R7177:Pcnx3	UTSW	19	5687499	missense	probably benign	0.01
R7308:Pcnx3	UTSW	19	5686147	missense	possibly damaging	0.52
R7387:Pcnx3	UTSW	19	5673336	missense	probably benign	0.33
R7488:Pcnx3	UTSW	19	5667459	missense	possibly damaging	0.72
R7670:Pcnx3	UTSW	19	5677182	missense	probably benign	0.03
R7831:Pcnx3	UTSW	19	5685961	missense	probably damaging	0.96
R7850:Pcnx3	UTSW	19	5678932	missense	possibly damaging	0.55
R8120:Pcnx3	UTSW	19	5667546	missense	probably benign
R8139:Pcnx3	UTSW	19	5665745	missense	probably benign	0.00
R8258:Pcnx3	UTSW	19	5665384	missense	probably damaging	1.00
R8259:Pcnx3	UTSW	19	5665384	missense	probably damaging	1.00
R8260:Pcnx3	UTSW	19	5665384	missense	probably damaging	1.00
R8261:Pcnx3	UTSW	19	5665384	missense	probably damaging	1.00
R8262:Pcnx3	UTSW	19	5665384	missense	probably damaging	1.00
R8350:Pcnx3	UTSW	19	5673226	missense	probably damaging	1.00
R8411:Pcnx3	UTSW	19	5679590	missense	possibly damaging	0.90
R8431:Pcnx3	UTSW	19	5665384	missense	probably damaging	1.00
R8443:Pcnx3	UTSW	19	5686642	missense	probably benign
R8450:Pcnx3	UTSW	19	5673226	missense	probably damaging	1.00
R8494:Pcnx3	UTSW	19	5675376	missense	probably damaging	0.99
R8790:Pcnx3	UTSW	19	5685178	missense	possibly damaging	0.71
R8939:Pcnx3	UTSW	19	5680319	missense	probably damaging	0.98
R9065:Pcnx3	UTSW	19	5667554	missense	possibly damaging	0.86
R9070:Pcnx3	UTSW	19	5665573	missense	probably benign	0.33
X0028:Pcnx3	UTSW	19	5684427	missense	probably damaging	1.00
X0053:Pcnx3	UTSW	19	5686622	splice site	probably null
Z1176:Pcnx3	UTSW	19	5687220	critical splice acceptor site	probably null
Z1177:Pcnx3	UTSW	19	5671626	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- GAGCTGACATCAGGACTGAG -3'
(R):5'- TTTCCTACAGGCAGCAGTGAG -3'

Sequencing Primer
(F):5'- CATCAGGACTGAGGCTGAGGTC -3'
(R):5'- CCCTCAGTGGCTCTGGTGATG -3'

Posted On

2020-10-20