Incidental Mutation 'R8430:Olfr599'
ID653708
Institutional Source Beutler Lab
Gene Symbol Olfr599
Ensembl Gene ENSMUSG00000073950
Gene Nameolfactory receptor 599
SynonymsGA_x6K02T2PBJ9-6047402-6048349, MOR23-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R8430 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location103335917-103339564 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 103338957 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 301 (R301L)
Ref Sequence ENSEMBL: ENSMUSP00000149281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098201] [ENSMUST00000214329] [ENSMUST00000215042]
Predicted Effect probably benign
Transcript: ENSMUST00000098201
AA Change: R301L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000095803
Gene: ENSMUSG00000073950
AA Change: R301L

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 1.8e-94 PFAM
Pfam:7TM_GPCR_Srsx 37 308 1.2e-6 PFAM
Pfam:7tm_1 43 293 2.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214329
AA Change: R301L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000215042
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass G A 6: 23,078,982 T677I probably benign Het
Adh4 T G 3: 138,422,384 N190K probably damaging Het
Ahnak2 A T 12: 112,774,687 S984T possibly damaging Het
Aknad1 A G 3: 108,751,721 D17G possibly damaging Het
Ankrd11 T C 8: 122,893,366 N1249S probably benign Het
Ankrd31 A G 13: 96,851,691 K1071E possibly damaging Het
Atp1a3 A G 7: 24,999,012 L120P probably damaging Het
AU040320 C A 4: 126,848,900 A986E possibly damaging Het
Camkv T C 9: 107,947,769 M323T probably damaging Het
Cdh18 T G 15: 23,226,684 L77R probably damaging Het
Col24a1 C T 3: 145,315,299 T477M probably damaging Het
Cpeb3 A T 19: 37,025,006 F669I probably damaging Het
Cramp1l A T 17: 24,977,562 H859Q probably damaging Het
Csnk1g1 C A 9: 65,999,521 T140K probably damaging Het
Ctnnbl1 A G 2: 157,836,683 E402G probably damaging Het
Cyp20a1 T C 1: 60,363,329 V191A possibly damaging Het
Dkk3 A G 7: 112,121,646 Y158H probably damaging Het
Fgfr2 T C 7: 130,163,978 N835S probably damaging Het
Fggy GCACCA GCA 4: 95,926,765 probably benign Het
Gpatch1 G A 7: 35,308,209 T142M probably damaging Het
Gtf3c2 G A 5: 31,173,059 A189V probably damaging Het
Heatr5b T C 17: 78,829,624 I156V probably damaging Het
Itpka T A 2: 119,749,554 V258E probably damaging Het
Klhdc4 A G 8: 121,799,513 S327P possibly damaging Het
L1td1 C T 4: 98,737,872 T702I probably damaging Het
Lap3 A G 5: 45,497,384 D110G probably benign Het
Mab21l1 C A 3: 55,783,409 A139E probably damaging Het
Myo15b G A 11: 115,882,223 V173M probably benign Het
Olfr1022 A T 2: 85,869,182 M197L probably benign Het
Olfr1112 T G 2: 87,192,220 S178A possibly damaging Het
Olfr47 G A 6: 43,235,960 M117I probably benign Het
Rdh7 A G 10: 127,887,626 I120T probably benign Het
Rsph3a G T 17: 7,952,571 G173W probably damaging Het
Sec22b T C 3: 97,921,230 F203S probably benign Het
Sulf2 C T 2: 166,074,816 G867E probably benign Het
Tia1 A T 6: 86,418,924 D90V probably benign Het
Tiam2 A G 17: 3,518,262 D1561G probably benign Het
Trav9d-1 A G 14: 52,792,760 Y107C probably damaging Het
Trim32 T C 4: 65,614,706 V500A probably damaging Het
Ube2f G A 1: 91,254,267 probably benign Het
Ulk4 C T 9: 121,257,078 probably null Het
Zfp940 A G 7: 29,845,346 F379L probably benign Het
Other mutations in Olfr599
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Olfr599 APN 7 103338767 nonsense probably null
IGL01744:Olfr599 APN 7 103338228 missense probably damaging 0.98
IGL02011:Olfr599 APN 7 103338849 missense probably damaging 0.98
IGL02328:Olfr599 APN 7 103338290 missense probably damaging 1.00
IGL02630:Olfr599 APN 7 103338429 missense probably damaging 1.00
IGL03119:Olfr599 APN 7 103338722 missense probably damaging 1.00
PIT4468001:Olfr599 UTSW 7 103338600 missense probably damaging 1.00
R0599:Olfr599 UTSW 7 103338186 missense probably damaging 1.00
R4084:Olfr599 UTSW 7 103338320 missense probably damaging 0.99
R5068:Olfr599 UTSW 7 103338022 start gained probably null
R5069:Olfr599 UTSW 7 103338022 start gained probably null
R5280:Olfr599 UTSW 7 103338501 missense probably benign
R5816:Olfr599 UTSW 7 103338995 missense probably benign 0.00
R6560:Olfr599 UTSW 7 103338738 missense probably benign 0.02
R7001:Olfr599 UTSW 7 103338221 missense possibly damaging 0.51
R7890:Olfr599 UTSW 7 103338330 missense probably benign
R8295:Olfr599 UTSW 7 103338267 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ATGGCTGTAGTCAAGCTGGC -3'
(R):5'- TCCCATGCTGACTGGTTTTG -3'

Sequencing Primer
(F):5'- GCATTCAACACTTGTACGGC -3'
(R):5'- GTCTTGAGAATATAGACTGGCTTTTC -3'
Posted On2020-10-20