Mutagenetix > Incidental Mutation

Incidental Mutation 'R0308:Plxna4'

65371

Institutional Source

Beutler Lab

Gene Symbol

Plxna4

Ensembl Gene

ENSMUSG00000029765

Gene Name

plexin A4

Synonyms

Plxa4

MMRRC Submission

038518-MU

Accession Numbers

Genbank: NM_175750

Essential gene?

Possibly non essential (E-score: 0.373) question?

Stock #

R0308 (G1)

Quality Score

158

Status

Validated

Chromosome

Chromosomal Location

32144268-32588192 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 32237768 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 593 (T593S)

Ref Sequence

ENSEMBL: ENSMUSP00000110748 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115096]

AlphaFold

Q80UG2

Predicted Effect

probably benign
Transcript: ENSMUST00000115096
AA Change: T593S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000110748
Gene: ENSMUSG00000029765
AA Change: T593S

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Sema	50	490	2.3e-131	SMART
PSI	508	558	2.21e-14	SMART
PSI	654	701	2.44e-7	SMART
PSI	802	855	1.2e-6	SMART
IPT	856	950	7.25e-16	SMART
IPT	952	1036	4.1e-15	SMART
IPT	1038	1138	2.86e-14	SMART
IPT	1140	1229	6.88e-1	SMART
transmembrane domain	1237	1259	N/A	INTRINSIC
Pfam:Plexin_cytopl	1310	1863	1.8e-264	PFAM

Meta Mutation Damage Score

0.0694

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 95.1%
20x: 89.5%

Validation Efficiency

100% (82/82)

MGI Phenotype

PHENOTYPE: Homozygous null mice exhibit defective trajecotory and projection of peripheral sensory axons and sympathetic ganglion axons and the formation of the anterior commissure and the barrels. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700009N14Rik	A	T	4: 39,450,989	D65V	probably damaging	Het
4933407L21Rik	A	T	1: 85,931,286		probably benign	Het
Abcc12	C	T	8: 86,557,752		probably benign	Het
Adamts12	A	G	15: 11,311,560	E1301G	probably damaging	Het
Adh4	A	T	3: 138,424,102	N230Y	probably damaging	Het
Anapc15-ps	T	A	10: 95,673,092	M109L	probably benign	Het
Angpt2	T	C	8: 18,692,125	I472V	possibly damaging	Het
Arhgef26	C	A	3: 62,340,399	D301E	probably benign	Het
Armc10	G	A	5: 21,647,297		probably benign	Het
Arntl	A	T	7: 113,291,536	I179F	probably damaging	Het
Atm	T	C	9: 53,454,473		probably null	Het
Atp5b	T	C	10: 128,086,039	V265A	probably benign	Het
Atp8b1	G	T	18: 64,545,244	C860*	probably null	Het
Atrnl1	T	G	19: 57,753,288	S1160A	probably benign	Het
Cep55	A	G	19: 38,060,211	E105G	possibly damaging	Het
Cfap54	C	A	10: 92,885,364	D2502Y	unknown	Het
Cilp2	A	G	8: 69,882,993	S452P	probably benign	Het
Clptm1l	A	G	13: 73,611,667	D282G	possibly damaging	Het
Csrp1	C	A	1: 135,745,286	T47N	probably damaging	Het
Cyp2c40	T	A	19: 39,777,988	I388F	probably damaging	Het
Dars	C	T	1: 128,364,259	R494H	probably damaging	Het
Dna2	T	C	10: 62,956,974	V256A	probably damaging	Het
Dock7	T	C	4: 98,984,814	T1132A	probably benign	Het
Elk3	A	T	10: 93,265,205	M228K	probably benign	Het
Erich6	A	G	3: 58,636,104	F182L	probably damaging	Het
Fhad1	A	G	4: 141,985,593		probably benign	Het
Fryl	A	T	5: 73,041,604		probably benign	Het
Fzd9	A	T	5: 135,249,406	C542S	probably damaging	Het
Gba	A	G	3: 89,208,364	T460A	probably benign	Het
Gli2	C	T	1: 118,842,062	A587T	probably benign	Het
Gm10037	A	G	13: 67,843,113		probably benign	Het
Gm11011	C	T	2: 169,582,694		probably benign	Het
Gm17018	T	G	19: 45,577,006	F140V	probably damaging	Het
Gm9745	T	G	13: 8,940,841		probably benign	Het
Gmppb	A	G	9: 108,049,834	E68G	probably benign	Het
Gpld1	A	G	13: 24,962,835	N260S	possibly damaging	Het
Hipk3	G	A	2: 104,433,207	S900L	probably damaging	Het
Ints6l	A	T	X: 56,481,355	M215L	possibly damaging	Het
Irx6	T	A	8: 92,677,031	L128Q	probably damaging	Het
Itga10	T	C	3: 96,651,464	S373P	probably damaging	Het
Jak1	T	C	4: 101,154,535		probably null	Het
Jak2	C	T	19: 29,311,757	T1103I	probably benign	Het
Katnal1	A	T	5: 148,878,924	V401D	possibly damaging	Het
Lrp2	T	A	2: 69,482,982		probably benign	Het
Map3k13	A	G	16: 21,891,988	H7R	probably benign	Het
Mrgprx3-ps	A	G	7: 47,310,018	V75A	probably benign	Het
Nol6	C	T	4: 41,123,584	A55T	probably benign	Het
Olfr881	A	G	9: 37,992,845	I118V	probably benign	Het
Opa1	G	A	16: 29,621,531	R818Q	probably damaging	Het
Opn4	T	C	14: 34,597,124	Y168C	possibly damaging	Het
Phf21a	T	C	2: 92,330,777	V330A	possibly damaging	Het
Phykpl	A	G	11: 51,593,596		probably benign	Het
Plcb1	T	G	2: 134,813,614	V38G	probably benign	Het
Poll	A	T	19: 45,555,965	I339N	probably damaging	Het
Rev3l	A	G	10: 39,824,894	I1796V	probably benign	Het
Rnf103	G	A	6: 71,509,702	R439H	probably damaging	Het
Rrn3	G	A	16: 13,799,882		probably benign	Het
Sec14l4	G	A	11: 4,041,726		probably benign	Het
Sec23a	A	C	12: 59,007,199	Y4*	probably null	Het
Senp6	T	C	9: 80,132,983		probably null	Het
Serpinb6b	A	T	13: 32,978,237	N221Y	probably benign	Het
Slc6a2	A	G	8: 92,961,360	E38G	possibly damaging	Het
Smap1	A	T	1: 23,849,342	L196I	probably damaging	Het
Sorbs2	C	T	8: 45,795,130	Q473*	probably null	Het
Sphkap	C	A	1: 83,276,969	V1020F	probably damaging	Het
Srfbp1	T	C	18: 52,488,542	V225A	probably benign	Het
Srprb	G	A	9: 103,202,005	P728S	possibly damaging	Het
Tarm1	T	C	7: 3,496,671		probably benign	Het
Tcp1	T	A	17: 12,920,419	I162N	probably benign	Het
Tmem237	C	A	1: 59,107,517	A292S	probably damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Tnpo1	A	G	13: 98,846,503	F884L	probably damaging	Het
Trim7	A	G	11: 48,849,501	T142A	probably damaging	Het
Ttn	T	A	2: 76,785,680	I14894F	probably damaging	Het
Tubgcp6	T	C	15: 89,122,436	R128G	possibly damaging	Het
Ube2d2b	A	G	5: 107,830,908	T142A	possibly damaging	Het
Unc13c	G	T	9: 73,481,118	L2129I	probably benign	Het
Ushbp1	T	C	8: 71,391,053	D247G	probably damaging	Het
Usp43	G	A	11: 67,880,140	A556V	probably damaging	Het
Zfp438	T	A	18: 5,213,638	H440L	probably benign	Het
Zfp518b	C	T	5: 38,672,770	E631K	possibly damaging	Het

Other mutations in Plxna4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Plxna4	APN	6	32162091	missense	probably damaging	1.00
IGL01395:Plxna4	APN	6	32239433	missense	probably damaging	0.99
IGL01506:Plxna4	APN	6	32516535	missense	probably damaging	1.00
IGL01606:Plxna4	APN	6	32158001	missense	probably damaging	1.00
IGL01753:Plxna4	APN	6	32310478	missense	probably benign	0.06
IGL01767:Plxna4	APN	6	32237678	missense	possibly damaging	0.51
IGL01968:Plxna4	APN	6	32215204	missense	possibly damaging	0.81
IGL02109:Plxna4	APN	6	32215641	missense	probably benign
IGL02299:Plxna4	APN	6	32165156	missense	probably benign	0.01
IGL02306:Plxna4	APN	6	32206124	missense	probably benign	0.19
IGL02312:Plxna4	APN	6	32165117	missense	possibly damaging	0.79
IGL02326:Plxna4	APN	6	32152905	missense	probably damaging	0.99
IGL02658:Plxna4	APN	6	32185411	missense	probably damaging	1.00
IGL02683:Plxna4	APN	6	32517606	missense	probably benign	0.03
IGL02701:Plxna4	APN	6	32517559	missense	probably benign	0.01
IGL02995:Plxna4	APN	6	32516595	missense	probably damaging	1.00
IGL03030:Plxna4	APN	6	32202225	missense	probably benign	0.01
IGL03264:Plxna4	APN	6	32178402	missense	possibly damaging	0.64
IGL03304:Plxna4	APN	6	32165051	splice site	probably benign
IGL03382:Plxna4	APN	6	32202194	missense	probably benign	0.23
corona	UTSW	6	32517264	missense	probably damaging	1.00
Disposed	UTSW	6	32516505	missense	probably damaging	1.00
inclined	UTSW	6	32237723	nonsense	probably null
Slope	UTSW	6	32234606	missense	probably benign	0.00
G4846:Plxna4	UTSW	6	32192272	missense	probably damaging	1.00
R0133:Plxna4	UTSW	6	32197074	missense	probably benign	0.00
R0200:Plxna4	UTSW	6	32197088	missense	probably damaging	0.99
R0468:Plxna4	UTSW	6	32215246	missense	probably damaging	1.00
R0505:Plxna4	UTSW	6	32202119	missense	probably benign
R0542:Plxna4	UTSW	6	32192297	missense	probably damaging	1.00
R0548:Plxna4	UTSW	6	32158015	missense	probably damaging	1.00
R0652:Plxna4	UTSW	6	32185501	missense	probably damaging	1.00
R1144:Plxna4	UTSW	6	32197156	missense	possibly damaging	0.58
R1190:Plxna4	UTSW	6	32251136	missense	probably damaging	1.00
R1228:Plxna4	UTSW	6	32224152	splice site	probably null
R1569:Plxna4	UTSW	6	32185475	missense	possibly damaging	0.78
R1803:Plxna4	UTSW	6	32517444	missense	probably damaging	0.98
R1832:Plxna4	UTSW	6	32197826	missense	probably benign	0.01
R2068:Plxna4	UTSW	6	32517616	missense	possibly damaging	0.66
R2157:Plxna4	UTSW	6	32516974	missense	probably benign	0.00
R2842:Plxna4	UTSW	6	32215631	critical splice donor site	probably null
R2849:Plxna4	UTSW	6	32185532	missense	probably damaging	1.00
R2892:Plxna4	UTSW	6	32517037	missense	probably damaging	1.00
R2930:Plxna4	UTSW	6	32165780	missense	probably damaging	1.00
R3892:Plxna4	UTSW	6	32215654	missense	probably damaging	1.00
R4065:Plxna4	UTSW	6	32236365	nonsense	probably null
R4276:Plxna4	UTSW	6	32200948	missense	probably benign	0.29
R4307:Plxna4	UTSW	6	32163509	missense	probably damaging	0.99
R4331:Plxna4	UTSW	6	32150545	nonsense	probably null
R4478:Plxna4	UTSW	6	32196133	missense	possibly damaging	0.89
R4529:Plxna4	UTSW	6	32496896	critical splice acceptor site	probably null
R4566:Plxna4	UTSW	6	32517403	missense	probably benign	0.00
R4568:Plxna4	UTSW	6	32152938	missense	probably damaging	1.00
R4664:Plxna4	UTSW	6	32516950	missense	possibly damaging	0.88
R4685:Plxna4	UTSW	6	32165844	missense	probably damaging	1.00
R4701:Plxna4	UTSW	6	32516688	missense	probably damaging	0.99
R4939:Plxna4	UTSW	6	32165762	missense	probably damaging	1.00
R5153:Plxna4	UTSW	6	32224159	splice site	probably null
R5181:Plxna4	UTSW	6	32516997	missense	probably damaging	1.00
R5256:Plxna4	UTSW	6	32251072	missense	probably benign	0.03
R5259:Plxna4	UTSW	6	32517021	missense	possibly damaging	0.89
R5306:Plxna4	UTSW	6	32206121	missense	probably damaging	0.99
R5487:Plxna4	UTSW	6	32517283	missense	probably damaging	1.00
R5510:Plxna4	UTSW	6	32178358	missense	probably damaging	0.96
R5542:Plxna4	UTSW	6	32206230	missense	probably damaging	1.00
R5567:Plxna4	UTSW	6	32157980	missense	possibly damaging	0.61
R5634:Plxna4	UTSW	6	32237723	nonsense	probably null
R5653:Plxna4	UTSW	6	32517616	missense	possibly damaging	0.66
R5665:Plxna4	UTSW	6	32215722	missense	probably damaging	1.00
R5845:Plxna4	UTSW	6	32237776	missense	probably damaging	1.00
R5909:Plxna4	UTSW	6	32517246	missense	probably damaging	1.00
R5938:Plxna4	UTSW	6	32234606	missense	probably benign	0.00
R5973:Plxna4	UTSW	6	32251065	splice site	probably null
R6433:Plxna4	UTSW	6	32215678	missense	probably damaging	0.97
R6482:Plxna4	UTSW	6	32516737	missense	probably benign
R6560:Plxna4	UTSW	6	32215678	missense	probably damaging	0.97
R6721:Plxna4	UTSW	6	32200859	missense	probably benign	0.26
R6810:Plxna4	UTSW	6	32310522	missense	probably benign	0.18
R6985:Plxna4	UTSW	6	32237708	missense	probably damaging	1.00
R7024:Plxna4	UTSW	6	32192269	missense	probably damaging	1.00
R7046:Plxna4	UTSW	6	32516505	missense	probably damaging	1.00
R7137:Plxna4	UTSW	6	32517264	missense	probably damaging	1.00
R7163:Plxna4	UTSW	6	32496756	missense	probably benign	0.01
R7199:Plxna4	UTSW	6	32215178	nonsense	probably null
R7248:Plxna4	UTSW	6	32162160	missense	probably damaging	0.99
R7260:Plxna4	UTSW	6	32239520	missense	possibly damaging	0.79
R7361:Plxna4	UTSW	6	32196122	critical splice donor site	probably null
R7383:Plxna4	UTSW	6	32152799	critical splice donor site	probably null
R7405:Plxna4	UTSW	6	32196319	missense	probably benign	0.00
R7516:Plxna4	UTSW	6	32237768	missense	probably benign	0.00
R7635:Plxna4	UTSW	6	32496741	missense	probably damaging	0.98
R7754:Plxna4	UTSW	6	32152872	missense	probably damaging	1.00
R7763:Plxna4	UTSW	6	32223980	missense	probably damaging	0.99
R7789:Plxna4	UTSW	6	32206233	critical splice acceptor site	probably null
R8167:Plxna4	UTSW	6	32517046	missense	probably damaging	0.99
R8191:Plxna4	UTSW	6	32516950	missense	possibly damaging	0.88
R8225:Plxna4	UTSW	6	32162103	missense	probably damaging	1.00
R8284:Plxna4	UTSW	6	32152854	missense	probably benign	0.25
R8305:Plxna4	UTSW	6	32211065	missense	possibly damaging	0.81
R8438:Plxna4	UTSW	6	32202180	missense	probably damaging	1.00
R8493:Plxna4	UTSW	6	32215712	missense	probably benign	0.27
R8714:Plxna4	UTSW	6	32163444	nonsense	probably null
R8759:Plxna4	UTSW	6	32192341	missense	probably damaging	1.00
R8822:Plxna4	UTSW	6	32150496	missense	possibly damaging	0.89
R8844:Plxna4	UTSW	6	32197091	missense	probably benign	0.11
R8974:Plxna4	UTSW	6	32239512	missense	possibly damaging	0.79
R9020:Plxna4	UTSW	6	32234562	missense	possibly damaging	0.90
R9144:Plxna4	UTSW	6	32185561	missense	possibly damaging	0.77
R9206:Plxna4	UTSW	6	32517444	missense	probably damaging	0.98
R9208:Plxna4	UTSW	6	32517444	missense	probably damaging	0.98
R9257:Plxna4	UTSW	6	32162083	missense	probably damaging	0.99
R9269:Plxna4	UTSW	6	32178380	missense	probably benign	0.00
R9411:Plxna4	UTSW	6	32182747	missense	probably damaging	1.00
R9469:Plxna4	UTSW	6	32517591	missense	probably benign
R9583:Plxna4	UTSW	6	32215234	missense	possibly damaging	0.78
R9647:Plxna4	UTSW	6	32251109	missense	probably damaging	1.00
R9695:Plxna4	UTSW	6	32206121	missense	probably benign	0.02
R9801:Plxna4	UTSW	6	32163591	critical splice acceptor site	probably null
V1024:Plxna4	UTSW	6	32234574	missense	probably damaging	1.00
X0027:Plxna4	UTSW	6	32517044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTGCTACCCAGGCACAATGAAAAG -3'
(R):5'- GGGACCAAATCCATTCCGATCCAAG -3'

Sequencing Primer
(F):5'- AAGTCTGCCACCCAACTTTG -3'
(R):5'- GCACTCTTGTAACAAGCTGG -3'

Posted On

2013-08-08