Incidental Mutation 'R8430:Klhdc4'
ID653711
Institutional Source Beutler Lab
Gene Symbol Klhdc4
Ensembl Gene ENSMUSG00000040263
Gene Namekelch domain containing 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R8430 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location121796313-121829569 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121799513 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 327 (S327P)
Ref Sequence ENSEMBL: ENSMUSP00000043439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045884] [ENSMUST00000127664] [ENSMUST00000174192] [ENSMUST00000174665] [ENSMUST00000174717]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045884
AA Change: S327P

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000043439
Gene: ENSMUSG00000040263
AA Change: S327P

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
Pfam:Kelch_4 63 118 8.3e-11 PFAM
Pfam:Kelch_3 75 125 1.7e-9 PFAM
Pfam:Kelch_6 118 174 2.4e-9 PFAM
Pfam:Kelch_4 118 175 3e-8 PFAM
Pfam:Kelch_3 131 185 2e-8 PFAM
Pfam:Kelch_5 173 216 7.5e-9 PFAM
Pfam:Kelch_3 186 239 2.1e-6 PFAM
Pfam:Kelch_1 295 345 4.6e-6 PFAM
Pfam:Kelch_2 295 349 2.1e-7 PFAM
low complexity region 489 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174192
AA Change: S270P

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134487
Gene: ENSMUSG00000040263
AA Change: S270P

DomainStartEndE-ValueType
Pfam:Kelch_3 32 70 1.5e-6 PFAM
Pfam:Kelch_6 61 117 1.9e-8 PFAM
Pfam:Kelch_4 61 118 6.9e-8 PFAM
Pfam:Kelch_3 74 128 4.6e-8 PFAM
Pfam:Kelch_5 116 159 1.4e-7 PFAM
Pfam:Kelch_4 119 172 2.2e-6 PFAM
Pfam:Kelch_3 129 182 7e-7 PFAM
Pfam:Kelch_2 238 292 1.8e-7 PFAM
low complexity region 432 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174665
SMART Domains Protein: ENSMUSP00000134474
Gene: ENSMUSG00000040263

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 57 67 N/A INTRINSIC
low complexity region 104 114 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000174717
AA Change: S296P

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134361
Gene: ENSMUSG00000040263
AA Change: S296P

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
Pfam:Kelch_4 63 117 1.4e-8 PFAM
Pfam:Kelch_3 75 127 9.6e-11 PFAM
Pfam:Kelch_4 118 170 2.3e-7 PFAM
Pfam:Kelch_6 118 174 9.3e-9 PFAM
low complexity region 191 202 N/A INTRINSIC
Pfam:Kelch_2 264 318 2e-7 PFAM
low complexity region 458 489 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass G A 6: 23,078,982 T677I probably benign Het
Adh4 T G 3: 138,422,384 N190K probably damaging Het
Ahnak2 A T 12: 112,774,687 S984T possibly damaging Het
Aknad1 A G 3: 108,751,721 D17G possibly damaging Het
Ankrd11 T C 8: 122,893,366 N1249S probably benign Het
Ankrd31 A G 13: 96,851,691 K1071E possibly damaging Het
Atp1a3 A G 7: 24,999,012 L120P probably damaging Het
AU040320 C A 4: 126,848,900 A986E possibly damaging Het
Camkv T C 9: 107,947,769 M323T probably damaging Het
Cdh18 T G 15: 23,226,684 L77R probably damaging Het
Col24a1 C T 3: 145,315,299 T477M probably damaging Het
Cpeb3 A T 19: 37,025,006 F669I probably damaging Het
Cramp1l A T 17: 24,977,562 H859Q probably damaging Het
Csnk1g1 C A 9: 65,999,521 T140K probably damaging Het
Ctnnbl1 A G 2: 157,836,683 E402G probably damaging Het
Cyp20a1 T C 1: 60,363,329 V191A possibly damaging Het
Dkk3 A G 7: 112,121,646 Y158H probably damaging Het
Fgfr2 T C 7: 130,163,978 N835S probably damaging Het
Fggy GCACCA GCA 4: 95,926,765 probably benign Het
Gpatch1 G A 7: 35,308,209 T142M probably damaging Het
Gtf3c2 G A 5: 31,173,059 A189V probably damaging Het
Heatr5b T C 17: 78,829,624 I156V probably damaging Het
Itpka T A 2: 119,749,554 V258E probably damaging Het
L1td1 C T 4: 98,737,872 T702I probably damaging Het
Lap3 A G 5: 45,497,384 D110G probably benign Het
Mab21l1 C A 3: 55,783,409 A139E probably damaging Het
Myo15b G A 11: 115,882,223 V173M probably benign Het
Olfr1022 A T 2: 85,869,182 M197L probably benign Het
Olfr1112 T G 2: 87,192,220 S178A possibly damaging Het
Olfr47 G A 6: 43,235,960 M117I probably benign Het
Olfr599 G T 7: 103,338,957 R301L probably benign Het
Rdh7 A G 10: 127,887,626 I120T probably benign Het
Rsph3a G T 17: 7,952,571 G173W probably damaging Het
Sec22b T C 3: 97,921,230 F203S probably benign Het
Sulf2 C T 2: 166,074,816 G867E probably benign Het
Tia1 A T 6: 86,418,924 D90V probably benign Het
Tiam2 A G 17: 3,518,262 D1561G probably benign Het
Trav9d-1 A G 14: 52,792,760 Y107C probably damaging Het
Trim32 T C 4: 65,614,706 V500A probably damaging Het
Ube2f G A 1: 91,254,267 probably benign Het
Ulk4 C T 9: 121,257,078 probably null Het
Zfp940 A G 7: 29,845,346 F379L probably benign Het
Other mutations in Klhdc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Klhdc4 APN 8 121821843 nonsense probably null
IGL01678:Klhdc4 APN 8 121796938 missense possibly damaging 0.73
kilimanjaro UTSW 8 121813790 nonsense probably null
R0577:Klhdc4 UTSW 8 121821351 missense probably damaging 0.99
R0881:Klhdc4 UTSW 8 121799487 nonsense probably null
R1710:Klhdc4 UTSW 8 121799487 nonsense probably null
R2993:Klhdc4 UTSW 8 121806581 nonsense probably null
R3028:Klhdc4 UTSW 8 121799549 missense probably damaging 1.00
R3109:Klhdc4 UTSW 8 121821334 missense probably damaging 1.00
R3711:Klhdc4 UTSW 8 121798055 missense probably benign
R4132:Klhdc4 UTSW 8 121798065 missense possibly damaging 0.79
R4601:Klhdc4 UTSW 8 121799527 missense probably damaging 1.00
R4644:Klhdc4 UTSW 8 121822000 intron probably benign
R4758:Klhdc4 UTSW 8 121798044 missense probably benign 0.00
R4999:Klhdc4 UTSW 8 121796603 missense probably benign 0.00
R5177:Klhdc4 UTSW 8 121813790 nonsense probably null
R5364:Klhdc4 UTSW 8 121806636 intron probably benign
R5475:Klhdc4 UTSW 8 121799572 missense possibly damaging 0.67
R5705:Klhdc4 UTSW 8 121804993 missense probably benign 0.01
R6248:Klhdc4 UTSW 8 121813768 missense probably damaging 1.00
R6326:Klhdc4 UTSW 8 121805054 missense probably damaging 1.00
R6626:Klhdc4 UTSW 8 121820162 missense probably benign 0.43
R7274:Klhdc4 UTSW 8 121799658 critical splice acceptor site probably null
R7716:Klhdc4 UTSW 8 121829420 missense unknown
R8841:Klhdc4 UTSW 8 121796641 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- ACAGAAGAGTACATGTGCCTTC -3'
(R):5'- AATTATGCTCCCGCCATGTG -3'

Sequencing Primer
(F):5'- AAGAGTACATGTGCCTTCAAAAG -3'
(R):5'- TGGTTCTCAGTGAGCCCC -3'
Posted On2020-10-20