Incidental Mutation 'R0308:Cilp2'
ID65372
Institutional Source Beutler Lab
Gene Symbol Cilp2
Ensembl Gene ENSMUSG00000044006
Gene Namecartilage intermediate layer protein 2
Synonyms1110031K21Rik, CLIP-2
MMRRC Submission 038518-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0308 (G1)
Quality Score130
Status Validated
Chromosome8
Chromosomal Location69880369-69887687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69882993 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 452 (S452P)
Ref Sequence ENSEMBL: ENSMUSP00000061544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057831] [ENSMUST00000152938] [ENSMUST00000180068]
AlphaFold D3Z7H8
Predicted Effect probably benign
Transcript: ENSMUST00000057831
AA Change: S452P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000061544
Gene: ENSMUSG00000044006
AA Change: S452P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Mucin2_WxxW 58 143 2.5e-22 PFAM
TSP1 149 197 1.33e-9 SMART
Pfam:CarboxypepD_reg 210 288 4.5e-10 PFAM
IGc2 305 367 2.52e-9 SMART
low complexity region 472 481 N/A INTRINSIC
low complexity region 614 632 N/A INTRINSIC
low complexity region 693 703 N/A INTRINSIC
low complexity region 705 719 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 1041 1061 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152456
Predicted Effect probably benign
Transcript: ENSMUST00000152938
SMART Domains Protein: ENSMUSP00000118931
Gene: ENSMUSG00000048967

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:YjeF_N 17 187 5.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180068
SMART Domains Protein: ENSMUSP00000136145
Gene: ENSMUSG00000048967

DomainStartEndE-ValueType
Pfam:YjeF_N 2 159 8.8e-24 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.1%
  • 20x: 89.5%
Validation Efficiency 100% (82/82)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,450,989 D65V probably damaging Het
4933407L21Rik A T 1: 85,931,286 probably benign Het
Abcc12 C T 8: 86,557,752 probably benign Het
Adamts12 A G 15: 11,311,560 E1301G probably damaging Het
Adh4 A T 3: 138,424,102 N230Y probably damaging Het
Anapc15-ps T A 10: 95,673,092 M109L probably benign Het
Angpt2 T C 8: 18,692,125 I472V possibly damaging Het
Arhgef26 C A 3: 62,340,399 D301E probably benign Het
Armc10 G A 5: 21,647,297 probably benign Het
Arntl A T 7: 113,291,536 I179F probably damaging Het
Atm T C 9: 53,454,473 probably null Het
Atp5b T C 10: 128,086,039 V265A probably benign Het
Atp8b1 G T 18: 64,545,244 C860* probably null Het
Atrnl1 T G 19: 57,753,288 S1160A probably benign Het
Cep55 A G 19: 38,060,211 E105G possibly damaging Het
Cfap54 C A 10: 92,885,364 D2502Y unknown Het
Clptm1l A G 13: 73,611,667 D282G possibly damaging Het
Csrp1 C A 1: 135,745,286 T47N probably damaging Het
Cyp2c40 T A 19: 39,777,988 I388F probably damaging Het
Dars C T 1: 128,364,259 R494H probably damaging Het
Dna2 T C 10: 62,956,974 V256A probably damaging Het
Dock7 T C 4: 98,984,814 T1132A probably benign Het
Elk3 A T 10: 93,265,205 M228K probably benign Het
Erich6 A G 3: 58,636,104 F182L probably damaging Het
Fhad1 A G 4: 141,985,593 probably benign Het
Fryl A T 5: 73,041,604 probably benign Het
Fzd9 A T 5: 135,249,406 C542S probably damaging Het
Gba A G 3: 89,208,364 T460A probably benign Het
Gli2 C T 1: 118,842,062 A587T probably benign Het
Gm10037 A G 13: 67,843,113 probably benign Het
Gm11011 C T 2: 169,582,694 probably benign Het
Gm17018 T G 19: 45,577,006 F140V probably damaging Het
Gm9745 T G 13: 8,940,841 probably benign Het
Gmppb A G 9: 108,049,834 E68G probably benign Het
Gpld1 A G 13: 24,962,835 N260S possibly damaging Het
Hipk3 G A 2: 104,433,207 S900L probably damaging Het
Ints6l A T X: 56,481,355 M215L possibly damaging Het
Irx6 T A 8: 92,677,031 L128Q probably damaging Het
Itga10 T C 3: 96,651,464 S373P probably damaging Het
Jak1 T C 4: 101,154,535 probably null Het
Jak2 C T 19: 29,311,757 T1103I probably benign Het
Katnal1 A T 5: 148,878,924 V401D possibly damaging Het
Lrp2 T A 2: 69,482,982 probably benign Het
Map3k13 A G 16: 21,891,988 H7R probably benign Het
Mrgprx3-ps A G 7: 47,310,018 V75A probably benign Het
Nol6 C T 4: 41,123,584 A55T probably benign Het
Olfr881 A G 9: 37,992,845 I118V probably benign Het
Opa1 G A 16: 29,621,531 R818Q probably damaging Het
Opn4 T C 14: 34,597,124 Y168C possibly damaging Het
Phf21a T C 2: 92,330,777 V330A possibly damaging Het
Phykpl A G 11: 51,593,596 probably benign Het
Plcb1 T G 2: 134,813,614 V38G probably benign Het
Plxna4 T A 6: 32,237,768 T593S probably benign Het
Poll A T 19: 45,555,965 I339N probably damaging Het
Rev3l A G 10: 39,824,894 I1796V probably benign Het
Rnf103 G A 6: 71,509,702 R439H probably damaging Het
Rrn3 G A 16: 13,799,882 probably benign Het
Sec14l4 G A 11: 4,041,726 probably benign Het
Sec23a A C 12: 59,007,199 Y4* probably null Het
Senp6 T C 9: 80,132,983 probably null Het
Serpinb6b A T 13: 32,978,237 N221Y probably benign Het
Slc6a2 A G 8: 92,961,360 E38G possibly damaging Het
Smap1 A T 1: 23,849,342 L196I probably damaging Het
Sorbs2 C T 8: 45,795,130 Q473* probably null Het
Sphkap C A 1: 83,276,969 V1020F probably damaging Het
Srfbp1 T C 18: 52,488,542 V225A probably benign Het
Srprb G A 9: 103,202,005 P728S possibly damaging Het
Tarm1 T C 7: 3,496,671 probably benign Het
Tcp1 T A 17: 12,920,419 I162N probably benign Het
Tmem237 C A 1: 59,107,517 A292S probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnpo1 A G 13: 98,846,503 F884L probably damaging Het
Trim7 A G 11: 48,849,501 T142A probably damaging Het
Ttn T A 2: 76,785,680 I14894F probably damaging Het
Tubgcp6 T C 15: 89,122,436 R128G possibly damaging Het
Ube2d2b A G 5: 107,830,908 T142A possibly damaging Het
Unc13c G T 9: 73,481,118 L2129I probably benign Het
Ushbp1 T C 8: 71,391,053 D247G probably damaging Het
Usp43 G A 11: 67,880,140 A556V probably damaging Het
Zfp438 T A 18: 5,213,638 H440L probably benign Het
Zfp518b C T 5: 38,672,770 E631K possibly damaging Het
Other mutations in Cilp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Cilp2 APN 8 69882846 missense probably damaging 0.96
IGL01538:Cilp2 APN 8 69881204 missense probably benign 0.13
IGL02063:Cilp2 APN 8 69882865 missense probably damaging 1.00
IGL02582:Cilp2 APN 8 69881286 missense probably damaging 1.00
IGL02892:Cilp2 APN 8 69884320 missense probably benign 0.02
R0371:Cilp2 UTSW 8 69881606 missense probably damaging 1.00
R0413:Cilp2 UTSW 8 69882993 missense probably benign 0.00
R0414:Cilp2 UTSW 8 69882993 missense probably benign 0.00
R0470:Cilp2 UTSW 8 69885405 missense possibly damaging 0.87
R0838:Cilp2 UTSW 8 69881719 missense probably benign 0.04
R0842:Cilp2 UTSW 8 69883118 missense probably damaging 1.00
R1807:Cilp2 UTSW 8 69882194 missense probably damaging 1.00
R1864:Cilp2 UTSW 8 69881323 missense probably damaging 1.00
R2010:Cilp2 UTSW 8 69881694 missense probably damaging 1.00
R2104:Cilp2 UTSW 8 69882792 nonsense probably null
R2339:Cilp2 UTSW 8 69882894 missense probably benign 0.04
R4572:Cilp2 UTSW 8 69882410 missense probably damaging 1.00
R5225:Cilp2 UTSW 8 69883365 missense probably damaging 1.00
R5923:Cilp2 UTSW 8 69882875 missense probably damaging 1.00
R6113:Cilp2 UTSW 8 69882359 missense probably benign 0.00
R6958:Cilp2 UTSW 8 69882540 missense probably benign 0.01
R7108:Cilp2 UTSW 8 69881129 missense probably damaging 1.00
R7454:Cilp2 UTSW 8 69883390 missense probably damaging 1.00
R7455:Cilp2 UTSW 8 69881071 missense probably damaging 1.00
R7598:Cilp2 UTSW 8 69886032 missense probably benign 0.29
R7736:Cilp2 UTSW 8 69881421 missense probably damaging 1.00
R7781:Cilp2 UTSW 8 69882347 missense possibly damaging 0.81
R8924:Cilp2 UTSW 8 69886458 missense probably damaging 0.99
Z1088:Cilp2 UTSW 8 69885410 missense possibly damaging 0.94
Z1177:Cilp2 UTSW 8 69882808 missense probably damaging 0.99
Z1177:Cilp2 UTSW 8 69884542 missense probably damaging 1.00
Z1177:Cilp2 UTSW 8 69884546 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACGCTGTCTACGAAGTCTCCACTC -3'
(R):5'- CAGGAACACCTGATCAAGCTTCCG -3'

Sequencing Primer
(F):5'- GCACCTCGATGGTGAAGTC -3'
(R):5'- GGACGATTGCGGCCAAC -3'
Posted On2013-08-08