Incidental Mutation 'R8430:Tiam2'
ID653722
Institutional Source Beutler Lab
Gene Symbol Tiam2
Ensembl Gene ENSMUSG00000023800
Gene NameT cell lymphoma invasion and metastasis 2
Synonyms3000002F19Rik, STEF
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8430 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location3326573-3531344 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3518262 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1561 (D1561G)
Ref Sequence ENSEMBL: ENSMUSP00000072020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041003] [ENSMUST00000072156] [ENSMUST00000169838] [ENSMUST00000227405]
PDB Structure Crystal structure of the Tiam2 PHCCEx domain [X-RAY DIFFRACTION]
Low-resolution crystal structure of the Tiam2 PHCCEx domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000041003
SMART Domains Protein: ENSMUSP00000035291
Gene: ENSMUSG00000036983

DomainStartEndE-ValueType
rADc 43 234 5.56e-69 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072156
AA Change: D1561G

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000072020
Gene: ENSMUSG00000023800
AA Change: D1561G

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169838
AA Change: D1561G

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000125842
Gene: ENSMUSG00000023800
AA Change: D1561G

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227405
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor. A highly similar mouse protein specifically activates ras-related C3 botulinum substrate 1, converting this Rho-like guanosine triphosphatase (GTPase) from a guanosine diphosphate-bound inactive state to a guanosine triphosphate-bound active state. The encoded protein may play a role in neural cell development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass G A 6: 23,078,982 T677I probably benign Het
Adh4 T G 3: 138,422,384 N190K probably damaging Het
Ahnak2 A T 12: 112,774,687 S984T possibly damaging Het
Aknad1 A G 3: 108,751,721 D17G possibly damaging Het
Ankrd11 T C 8: 122,893,366 N1249S probably benign Het
Ankrd31 A G 13: 96,851,691 K1071E possibly damaging Het
Atp1a3 A G 7: 24,999,012 L120P probably damaging Het
AU040320 C A 4: 126,848,900 A986E possibly damaging Het
Camkv T C 9: 107,947,769 M323T probably damaging Het
Cdh18 T G 15: 23,226,684 L77R probably damaging Het
Col24a1 C T 3: 145,315,299 T477M probably damaging Het
Cpeb3 A T 19: 37,025,006 F669I probably damaging Het
Cramp1l A T 17: 24,977,562 H859Q probably damaging Het
Csnk1g1 C A 9: 65,999,521 T140K probably damaging Het
Ctnnbl1 A G 2: 157,836,683 E402G probably damaging Het
Cyp20a1 T C 1: 60,363,329 V191A possibly damaging Het
Dkk3 A G 7: 112,121,646 Y158H probably damaging Het
Fgfr2 T C 7: 130,163,978 N835S probably damaging Het
Fggy GCACCA GCA 4: 95,926,765 probably benign Het
Gpatch1 G A 7: 35,308,209 T142M probably damaging Het
Gtf3c2 G A 5: 31,173,059 A189V probably damaging Het
Heatr5b T C 17: 78,829,624 I156V probably damaging Het
Itpka T A 2: 119,749,554 V258E probably damaging Het
Klhdc4 A G 8: 121,799,513 S327P possibly damaging Het
L1td1 C T 4: 98,737,872 T702I probably damaging Het
Lap3 A G 5: 45,497,384 D110G probably benign Het
Mab21l1 C A 3: 55,783,409 A139E probably damaging Het
Myo15b G A 11: 115,882,223 V173M probably benign Het
Olfr1022 A T 2: 85,869,182 M197L probably benign Het
Olfr1112 T G 2: 87,192,220 S178A possibly damaging Het
Olfr47 G A 6: 43,235,960 M117I probably benign Het
Olfr599 G T 7: 103,338,957 R301L probably benign Het
Rdh7 A G 10: 127,887,626 I120T probably benign Het
Rsph3a G T 17: 7,952,571 G173W probably damaging Het
Sec22b T C 3: 97,921,230 F203S probably benign Het
Sulf2 C T 2: 166,074,816 G867E probably benign Het
Tia1 A T 6: 86,418,924 D90V probably benign Het
Trav9d-1 A G 14: 52,792,760 Y107C probably damaging Het
Trim32 T C 4: 65,614,706 V500A probably damaging Het
Ube2f G A 1: 91,254,267 probably benign Het
Ulk4 C T 9: 121,257,078 probably null Het
Zfp940 A G 7: 29,845,346 F379L probably benign Het
Other mutations in Tiam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Tiam2 APN 17 3415028 missense probably benign 0.21
IGL01320:Tiam2 APN 17 3505745 missense probably damaging 1.00
IGL01384:Tiam2 APN 17 3427202 missense probably benign 0.08
IGL01575:Tiam2 APN 17 3454316 missense probably damaging 1.00
IGL01769:Tiam2 APN 17 3427290 missense probably damaging 1.00
IGL02395:Tiam2 APN 17 3421481 missense possibly damaging 0.49
IGL02652:Tiam2 APN 17 3439696 splice site probably benign
IGL03102:Tiam2 APN 17 3509548 missense probably damaging 1.00
IGL03222:Tiam2 APN 17 3438708 missense probably damaging 0.97
Feste_burg UTSW 17 3414622 frame shift probably null
R0257:Tiam2 UTSW 17 3450813 missense possibly damaging 0.49
R0420:Tiam2 UTSW 17 3502918 missense probably benign 0.01
R0528:Tiam2 UTSW 17 3511071 missense probably damaging 1.00
R0532:Tiam2 UTSW 17 3421646 missense probably damaging 1.00
R0551:Tiam2 UTSW 17 3428954 missense probably damaging 1.00
R0554:Tiam2 UTSW 17 3438681 nonsense probably null
R0645:Tiam2 UTSW 17 3514698 missense possibly damaging 0.92
R0726:Tiam2 UTSW 17 3512833 unclassified probably benign
R1139:Tiam2 UTSW 17 3477267 missense possibly damaging 0.55
R1392:Tiam2 UTSW 17 3414197 missense possibly damaging 0.71
R1392:Tiam2 UTSW 17 3414197 missense possibly damaging 0.71
R1529:Tiam2 UTSW 17 3516703 missense probably benign 0.00
R1671:Tiam2 UTSW 17 3506834 missense probably damaging 1.00
R1731:Tiam2 UTSW 17 3518423 missense probably damaging 0.98
R1759:Tiam2 UTSW 17 3516003 missense probably damaging 0.98
R1850:Tiam2 UTSW 17 3437235 missense probably damaging 1.00
R1853:Tiam2 UTSW 17 3415135 missense probably damaging 1.00
R1855:Tiam2 UTSW 17 3415135 missense probably damaging 1.00
R1931:Tiam2 UTSW 17 3514725 missense possibly damaging 0.68
R1932:Tiam2 UTSW 17 3514725 missense possibly damaging 0.68
R1993:Tiam2 UTSW 17 3415126 nonsense probably null
R2211:Tiam2 UTSW 17 3414918 nonsense probably null
R2217:Tiam2 UTSW 17 3415114 missense probably benign 0.34
R2278:Tiam2 UTSW 17 3427220 missense probably damaging 0.96
R2407:Tiam2 UTSW 17 3477261 missense probably benign 0.14
R2516:Tiam2 UTSW 17 3453382 missense probably damaging 1.00
R2991:Tiam2 UTSW 17 3518250 missense probably benign
R3086:Tiam2 UTSW 17 3421582 missense probably damaging 1.00
R3121:Tiam2 UTSW 17 3439702 missense probably benign 0.01
R3686:Tiam2 UTSW 17 3421684 missense possibly damaging 0.87
R3740:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R3742:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R3826:Tiam2 UTSW 17 3507701 splice site probably benign
R3829:Tiam2 UTSW 17 3507701 splice site probably benign
R3844:Tiam2 UTSW 17 3421651 missense probably damaging 0.98
R3970:Tiam2 UTSW 17 3428831 missense probably damaging 1.00
R4060:Tiam2 UTSW 17 3428980 missense probably benign 0.00
R4296:Tiam2 UTSW 17 3450845 missense probably benign
R4357:Tiam2 UTSW 17 3450853 missense probably damaging 1.00
R4368:Tiam2 UTSW 17 3414683 missense probably benign 0.01
R4369:Tiam2 UTSW 17 3413967 start gained probably benign
R4524:Tiam2 UTSW 17 3514711 missense probably damaging 1.00
R4619:Tiam2 UTSW 17 3518342 missense probably damaging 1.00
R4715:Tiam2 UTSW 17 3454168 missense probably damaging 1.00
R4723:Tiam2 UTSW 17 3450317 missense probably benign 0.00
R4979:Tiam2 UTSW 17 3505710 missense probably damaging 1.00
R5182:Tiam2 UTSW 17 3438721 missense probably damaging 1.00
R5451:Tiam2 UTSW 17 3428996 missense probably damaging 1.00
R5728:Tiam2 UTSW 17 3414956 missense probably damaging 0.99
R5827:Tiam2 UTSW 17 3448489 missense probably benign 0.00
R5879:Tiam2 UTSW 17 3437265 missense probably damaging 1.00
R5960:Tiam2 UTSW 17 3438640 missense probably benign 0.24
R5974:Tiam2 UTSW 17 3414809 missense possibly damaging 0.51
R6198:Tiam2 UTSW 17 3414121 missense probably benign 0.06
R6222:Tiam2 UTSW 17 3453338 missense probably damaging 0.96
R6295:Tiam2 UTSW 17 3509556 missense probably damaging 1.00
R6355:Tiam2 UTSW 17 3414622 frame shift probably null
R6356:Tiam2 UTSW 17 3414622 frame shift probably null
R6454:Tiam2 UTSW 17 3438663 missense probably benign 0.00
R6497:Tiam2 UTSW 17 3506827 missense probably damaging 1.00
R6579:Tiam2 UTSW 17 3414622 frame shift probably null
R6580:Tiam2 UTSW 17 3414622 frame shift probably null
R6581:Tiam2 UTSW 17 3414622 frame shift probably null
R6582:Tiam2 UTSW 17 3414622 frame shift probably null
R6648:Tiam2 UTSW 17 3506873 missense probably damaging 1.00
R6705:Tiam2 UTSW 17 3518243 missense probably benign 0.01
R6758:Tiam2 UTSW 17 3518403 missense probably benign 0.01
R6836:Tiam2 UTSW 17 3414380 missense probably benign 0.17
R6924:Tiam2 UTSW 17 3507795 missense probably damaging 1.00
R6977:Tiam2 UTSW 17 3518659 missense probably damaging 1.00
R7051:Tiam2 UTSW 17 3448483 missense probably damaging 0.99
R7151:Tiam2 UTSW 17 3448385 missense probably benign 0.36
R7214:Tiam2 UTSW 17 3518412 missense possibly damaging 0.85
R7332:Tiam2 UTSW 17 3453369 missense probably damaging 1.00
R7334:Tiam2 UTSW 17 3503008 missense possibly damaging 0.92
R7414:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R7660:Tiam2 UTSW 17 3482605 start codon destroyed probably null 0.66
R7743:Tiam2 UTSW 17 3518156 missense possibly damaging 0.53
R7755:Tiam2 UTSW 17 3421316 missense probably benign 0.01
R7805:Tiam2 UTSW 17 3509410 missense probably damaging 1.00
R7813:Tiam2 UTSW 17 3437247 missense probably damaging 1.00
R7842:Tiam2 UTSW 17 3518124 missense possibly damaging 0.82
R7989:Tiam2 UTSW 17 3518249 nonsense probably null
R8011:Tiam2 UTSW 17 3448396 missense possibly damaging 0.92
R8221:Tiam2 UTSW 17 3518585 missense probably damaging 0.99
R8260:Tiam2 UTSW 17 3518319 missense possibly damaging 0.94
R8292:Tiam2 UTSW 17 3506867 missense probably benign 0.01
R8406:Tiam2 UTSW 17 3507790 missense possibly damaging 0.94
R8424:Tiam2 UTSW 17 3516041 missense probably damaging 1.00
R8424:Tiam2 UTSW 17 3516042 missense probably damaging 1.00
R8530:Tiam2 UTSW 17 3450812 missense probably benign 0.03
R8692:Tiam2 UTSW 17 3428807 missense probably damaging 1.00
R8902:Tiam2 UTSW 17 3477196 missense probably benign 0.00
X0027:Tiam2 UTSW 17 3414000 start codon destroyed probably null 1.00
X0060:Tiam2 UTSW 17 3450354 splice site probably null
X0065:Tiam2 UTSW 17 3505708 missense probably damaging 1.00
Z1088:Tiam2 UTSW 17 3415019 missense probably benign 0.01
Z1176:Tiam2 UTSW 17 3505776 missense probably null 1.00
Z1177:Tiam2 UTSW 17 3427263 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGGCCTTAACTCTACATTGC -3'
(R):5'- CGTCGGATTCCTCAGAGATTTTC -3'

Sequencing Primer
(F):5'- TTCCGTGTCATGTGGAGAAAAATG -3'
(R):5'- CAGTCTCTGGAACTGAATCTCAATG -3'
Posted On2020-10-20