Incidental Mutation 'R8430:Cramp1'
ID 653724
Institutional Source Beutler Lab
Gene Symbol Cramp1
Ensembl Gene ENSMUSG00000038002
Gene Name cramped chromatin regulator 1
Synonyms 5830477H08Rik, Tce4, Cramp1l
MMRRC Submission 067775-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8430 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 25180200-25234762 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 25196536 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 859 (H859Q)
Ref Sequence ENSEMBL: ENSMUSP00000073060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073337]
AlphaFold Q6PG95
Predicted Effect probably damaging
Transcript: ENSMUST00000073337
AA Change: H859Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073060
Gene: ENSMUSG00000038002
AA Change: H859Q

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
low complexity region 51 64 N/A INTRINSIC
low complexity region 100 126 N/A INTRINSIC
low complexity region 134 147 N/A INTRINSIC
SANT 159 219 3.68e-3 SMART
low complexity region 479 503 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 833 845 N/A INTRINSIC
low complexity region 889 903 N/A INTRINSIC
low complexity region 1069 1086 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
low complexity region 1141 1156 N/A INTRINSIC
low complexity region 1171 1185 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass G A 6: 23,078,981 (GRCm39) T677I probably benign Het
Adh4 T G 3: 138,128,145 (GRCm39) N190K probably damaging Het
Ahnak2 A T 12: 112,741,121 (GRCm39) S984T possibly damaging Het
Aknad1 A G 3: 108,659,037 (GRCm39) D17G possibly damaging Het
Ankrd11 T C 8: 123,620,105 (GRCm39) N1249S probably benign Het
Ankrd31 A G 13: 96,988,199 (GRCm39) K1071E possibly damaging Het
Atp1a3 A G 7: 24,698,437 (GRCm39) L120P probably damaging Het
AU040320 C A 4: 126,742,693 (GRCm39) A986E possibly damaging Het
Camkv T C 9: 107,824,968 (GRCm39) M323T probably damaging Het
Cdh18 T G 15: 23,226,770 (GRCm39) L77R probably damaging Het
Col24a1 C T 3: 145,021,060 (GRCm39) T477M probably damaging Het
Cpeb3 A T 19: 37,002,406 (GRCm39) F669I probably damaging Het
Csnk1g1 C A 9: 65,906,803 (GRCm39) T140K probably damaging Het
Ctnnbl1 A G 2: 157,678,603 (GRCm39) E402G probably damaging Het
Cyp20a1 T C 1: 60,402,488 (GRCm39) V191A possibly damaging Het
Dkk3 A G 7: 111,720,853 (GRCm39) Y158H probably damaging Het
Fgfr2 T C 7: 129,765,708 (GRCm39) N835S probably damaging Het
Fggy GCACCA GCA 4: 95,815,002 (GRCm39) probably benign Het
Gpatch1 G A 7: 35,007,634 (GRCm39) T142M probably damaging Het
Gtf3c2 G A 5: 31,330,403 (GRCm39) A189V probably damaging Het
Heatr5b T C 17: 79,137,053 (GRCm39) I156V probably damaging Het
Itpka T A 2: 119,580,035 (GRCm39) V258E probably damaging Het
Klhdc4 A G 8: 122,526,252 (GRCm39) S327P possibly damaging Het
L1td1 C T 4: 98,626,109 (GRCm39) T702I probably damaging Het
Lap3 A G 5: 45,654,726 (GRCm39) D110G probably benign Het
Mab21l1 C A 3: 55,690,830 (GRCm39) A139E probably damaging Het
Myo15b G A 11: 115,773,049 (GRCm39) V173M probably benign Het
Or12e1 T G 2: 87,022,564 (GRCm39) S178A possibly damaging Het
Or2a57 G A 6: 43,212,894 (GRCm39) M117I probably benign Het
Or52ab4 G T 7: 102,988,164 (GRCm39) R301L probably benign Het
Or5m10b A T 2: 85,699,526 (GRCm39) M197L probably benign Het
Rdh7 A G 10: 127,723,495 (GRCm39) I120T probably benign Het
Rsph3a G T 17: 8,171,403 (GRCm39) G173W probably damaging Het
Sec22b T C 3: 97,828,546 (GRCm39) F203S probably benign Het
Sulf2 C T 2: 165,916,736 (GRCm39) G867E probably benign Het
Tia1 A T 6: 86,395,906 (GRCm39) D90V probably benign Het
Tiam2 A G 17: 3,568,537 (GRCm39) D1561G probably benign Het
Trav9d-1 A G 14: 53,030,217 (GRCm39) Y107C probably damaging Het
Trim32 T C 4: 65,532,943 (GRCm39) V500A probably damaging Het
Ube2f G A 1: 91,181,989 (GRCm39) probably benign Het
Ulk4 C T 9: 121,086,144 (GRCm39) probably null Het
Zfp940 A G 7: 29,544,771 (GRCm39) F379L probably benign Het
Other mutations in Cramp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Cramp1 APN 17 25,202,925 (GRCm39) missense probably benign 0.11
IGL01360:Cramp1 APN 17 25,216,547 (GRCm39) missense probably damaging 1.00
IGL01966:Cramp1 APN 17 25,201,917 (GRCm39) missense probably benign 0.01
IGL02211:Cramp1 APN 17 25,196,610 (GRCm39) missense possibly damaging 0.94
IGL02474:Cramp1 APN 17 25,204,024 (GRCm39) missense probably damaging 0.98
IGL02798:Cramp1 APN 17 25,187,894 (GRCm39) splice site probably benign
IGL03340:Cramp1 APN 17 25,192,516 (GRCm39) missense probably damaging 1.00
Interred UTSW 17 25,202,956 (GRCm39) missense probably damaging 0.99
R0106:Cramp1 UTSW 17 25,191,350 (GRCm39) missense probably benign 0.30
R1054:Cramp1 UTSW 17 25,202,151 (GRCm39) missense probably damaging 1.00
R1220:Cramp1 UTSW 17 25,201,211 (GRCm39) missense probably damaging 1.00
R1341:Cramp1 UTSW 17 25,196,514 (GRCm39) missense probably damaging 1.00
R1491:Cramp1 UTSW 17 25,191,323 (GRCm39) missense probably benign 0.17
R1610:Cramp1 UTSW 17 25,202,925 (GRCm39) missense probably benign 0.11
R1649:Cramp1 UTSW 17 25,202,217 (GRCm39) missense probably damaging 1.00
R1795:Cramp1 UTSW 17 25,183,884 (GRCm39) missense probably damaging 1.00
R1856:Cramp1 UTSW 17 25,187,952 (GRCm39) missense probably damaging 1.00
R1881:Cramp1 UTSW 17 25,196,656 (GRCm39) splice site probably benign
R1968:Cramp1 UTSW 17 25,183,913 (GRCm39) missense probably damaging 1.00
R2047:Cramp1 UTSW 17 25,222,189 (GRCm39) nonsense probably null
R2099:Cramp1 UTSW 17 25,192,059 (GRCm39) missense probably benign 0.01
R2298:Cramp1 UTSW 17 25,216,454 (GRCm39) missense probably damaging 0.96
R3752:Cramp1 UTSW 17 25,190,532 (GRCm39) missense probably damaging 1.00
R3821:Cramp1 UTSW 17 25,193,756 (GRCm39) missense probably damaging 1.00
R3861:Cramp1 UTSW 17 25,216,588 (GRCm39) splice site probably benign
R4399:Cramp1 UTSW 17 25,198,559 (GRCm39) missense probably damaging 1.00
R4847:Cramp1 UTSW 17 25,204,063 (GRCm39) missense probably damaging 1.00
R4883:Cramp1 UTSW 17 25,201,293 (GRCm39) missense probably benign
R5579:Cramp1 UTSW 17 25,192,087 (GRCm39) missense possibly damaging 0.89
R5631:Cramp1 UTSW 17 25,204,577 (GRCm39) missense possibly damaging 0.93
R5716:Cramp1 UTSW 17 25,193,709 (GRCm39) missense probably damaging 0.99
R6589:Cramp1 UTSW 17 25,196,466 (GRCm39) splice site probably null
R6631:Cramp1 UTSW 17 25,202,931 (GRCm39) missense probably benign 0.40
R7307:Cramp1 UTSW 17 25,193,719 (GRCm39) missense possibly damaging 0.94
R7323:Cramp1 UTSW 17 25,201,379 (GRCm39) missense possibly damaging 0.90
R7672:Cramp1 UTSW 17 25,201,440 (GRCm39) missense probably damaging 0.96
R7832:Cramp1 UTSW 17 25,202,196 (GRCm39) missense probably damaging 0.96
R8071:Cramp1 UTSW 17 25,201,674 (GRCm39) missense probably damaging 0.99
R8244:Cramp1 UTSW 17 25,190,384 (GRCm39) missense probably damaging 1.00
R8783:Cramp1 UTSW 17 25,193,732 (GRCm39) missense probably damaging 0.99
R8890:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R8892:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R8894:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R8937:Cramp1 UTSW 17 25,202,956 (GRCm39) missense probably damaging 0.99
R8941:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R9029:Cramp1 UTSW 17 25,232,884 (GRCm39) missense probably damaging 1.00
R9047:Cramp1 UTSW 17 25,198,603 (GRCm39) missense possibly damaging 0.90
R9149:Cramp1 UTSW 17 25,187,920 (GRCm39) missense probably damaging 0.99
R9262:Cramp1 UTSW 17 25,232,920 (GRCm39) missense probably damaging 0.99
R9460:Cramp1 UTSW 17 25,222,281 (GRCm39) missense probably damaging 1.00
R9614:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9615:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9651:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9652:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9653:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9665:Cramp1 UTSW 17 25,196,545 (GRCm39) missense probably damaging 1.00
R9753:Cramp1 UTSW 17 25,191,320 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AGTGCCGTTTCCGTAGTTTC -3'
(R):5'- GGAAACGTCTTTCTTGGCTTAC -3'

Sequencing Primer
(F):5'- CTTTGGTGAGAAAAAGTCTGACTG -3'
(R):5'- ACTTCCTGGTGGGGCTGC -3'
Posted On 2020-10-20