Incidental Mutation 'R8431:Cfap65'
ID 653727
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
MMRRC Submission 067776-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.720) question?
Stock # R8431 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 74941230-74974758 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 74967203 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 249 (G249R)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect probably benign
Transcript: ENSMUST00000094844
AA Change: G249R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: G249R

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 A G 8: 124,694,873 (GRCm39) F273S Het
Abhd14b G T 9: 106,328,612 (GRCm39) A78S probably benign Het
Adamtsl5 G A 10: 80,181,228 (GRCm39) P51L probably benign Het
Adap1 A C 5: 139,259,180 (GRCm39) F336V probably benign Het
Ankrd33b T C 15: 31,305,248 (GRCm39) N172S probably damaging Het
Arhgap24 A G 5: 103,040,464 (GRCm39) E560G possibly damaging Het
Ascc2 A T 11: 4,614,227 (GRCm39) probably null Het
Bhlhe40 TG TGG 6: 108,641,818 (GRCm39) 254 probably null Het
Card6 A T 15: 5,129,758 (GRCm39) F546Y probably damaging Het
Cby3 T G 11: 50,250,084 (GRCm39) S2A probably damaging Het
Cct3 T C 3: 88,225,831 (GRCm39) S385P possibly damaging Het
Cpne3 C A 4: 19,526,316 (GRCm39) A408S probably damaging Het
Ctsr A C 13: 61,308,304 (GRCm39) L280R probably damaging Het
D930048N14Rik GGG GGGG 11: 51,541,946 (GRCm39) probably null Het
Dlg4 A G 11: 69,930,388 (GRCm39) I388V probably benign Het
Ednrb T A 14: 104,080,633 (GRCm39) I94F probably benign Het
Eftud2 C A 11: 102,737,062 (GRCm39) A573S probably benign Het
Fsip2 C A 2: 82,811,910 (GRCm39) P2743Q probably damaging Het
Gp2 C T 7: 119,042,010 (GRCm39) C505Y probably benign Het
Ier5 C A 1: 154,974,306 (GRCm39) D291Y probably benign Het
Ifi207 T C 1: 173,558,070 (GRCm39) I223V unknown Het
Ifi208 T C 1: 173,510,844 (GRCm39) V333A possibly damaging Het
Kank4 T C 4: 98,667,509 (GRCm39) I313V probably benign Het
Klhl7 T C 5: 24,343,473 (GRCm39) V263A possibly damaging Het
Klrg2 T C 6: 38,605,122 (GRCm39) D314G probably benign Het
Lrr1 T C 12: 69,225,470 (GRCm39) M382T possibly damaging Het
Ly6e A T 15: 74,830,190 (GRCm39) Q48L probably benign Het
Marchf6 C T 15: 31,505,892 (GRCm39) W43* probably null Het
Mepe A G 5: 104,486,047 (GRCm39) T396A possibly damaging Het
Myh8 T G 11: 67,174,440 (GRCm39) L229R possibly damaging Het
Ndufa10 C G 1: 92,379,732 (GRCm39) probably null Het
Nek1 C A 8: 61,487,066 (GRCm39) A272E possibly damaging Het
Nr1h2 T C 7: 44,199,767 (GRCm39) Y384C probably damaging Het
Or4c118 C A 2: 88,974,723 (GRCm39) V215F probably benign Het
Pcnx3 C T 19: 5,715,412 (GRCm39) G1946E probably damaging Het
Phf2 A G 13: 48,975,078 (GRCm39) F294S unknown Het
Polr3e A T 7: 120,530,528 (GRCm39) I173F probably damaging Het
Ppfia2 A T 10: 106,671,952 (GRCm39) R464* probably null Het
Ppp1r9a T A 6: 5,115,456 (GRCm39) S860T probably benign Het
Rnf144a T C 12: 26,377,300 (GRCm39) Y93C probably damaging Het
Ryr2 T C 13: 11,673,894 (GRCm39) E3390G probably benign Het
Scn7a T C 2: 66,534,164 (GRCm39) T504A possibly damaging Het
Slc26a5 T G 5: 22,018,904 (GRCm39) D645A probably damaging Het
Sp140l2 G A 1: 85,235,170 (GRCm39) H130Y probably benign Het
Ston2 T A 12: 91,615,071 (GRCm39) I446F probably damaging Het
Tcp11l1 G A 2: 104,530,314 (GRCm39) P57S probably damaging Het
Th G T 7: 142,446,801 (GRCm39) H488Q probably benign Het
Tmprss4 A T 9: 45,095,661 (GRCm39) I61N probably benign Het
Wdtc1 A G 4: 133,049,481 (GRCm39) probably null Het
Xpnpep1 T C 19: 52,983,937 (GRCm39) N596S probably benign Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74,958,342 (GRCm39) critical splice donor site probably null
IGL01526:Cfap65 APN 1 74,950,237 (GRCm39) missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74,966,353 (GRCm39) missense probably benign
IGL01780:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL01993:Cfap65 APN 1 74,959,702 (GRCm39) missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74,967,304 (GRCm39) missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02357:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02576:Cfap65 APN 1 74,942,617 (GRCm39) missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74,944,239 (GRCm39) missense probably benign 0.00
IGL02792:Cfap65 APN 1 74,966,337 (GRCm39) missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74,950,267 (GRCm39) nonsense probably null
IGL03101:Cfap65 APN 1 74,967,592 (GRCm39) missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74,966,778 (GRCm39) missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74,943,801 (GRCm39) missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74,967,501 (GRCm39) missense probably benign 0.05
R0077:Cfap65 UTSW 1 74,971,077 (GRCm39) missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74,971,117 (GRCm39) nonsense probably null
R0281:Cfap65 UTSW 1 74,966,230 (GRCm39) missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74,943,226 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,461 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,460 (GRCm39) missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74,965,603 (GRCm39) missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74,959,760 (GRCm39) missense probably benign 0.00
R0361:Cfap65 UTSW 1 74,964,599 (GRCm39) missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74,956,043 (GRCm39) missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74,957,603 (GRCm39) missense probably benign 0.01
R0646:Cfap65 UTSW 1 74,941,328 (GRCm39) missense probably benign 0.09
R0734:Cfap65 UTSW 1 74,958,046 (GRCm39) missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74,943,841 (GRCm39) missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74,960,678 (GRCm39) missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74,944,872 (GRCm39) missense probably damaging 0.99
R1079:Cfap65 UTSW 1 74,941,606 (GRCm39) missense probably damaging 0.98
R1083:Cfap65 UTSW 1 74,957,663 (GRCm39) splice site probably benign
R1159:Cfap65 UTSW 1 74,968,499 (GRCm39) missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74,964,263 (GRCm39) missense probably benign 0.03
R1644:Cfap65 UTSW 1 74,956,334 (GRCm39) missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74,958,107 (GRCm39) missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74,946,819 (GRCm39) missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74,956,358 (GRCm39) missense probably benign 0.30
R2132:Cfap65 UTSW 1 74,946,850 (GRCm39) missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74,956,432 (GRCm39) frame shift probably null
R2219:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74,965,634 (GRCm39) missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74,966,345 (GRCm39) small insertion probably benign
R3114:Cfap65 UTSW 1 74,966,291 (GRCm39) missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74,959,701 (GRCm39) missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74,966,840 (GRCm39) missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74,942,517 (GRCm39) missense probably benign 0.17
R4547:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74,943,215 (GRCm39) missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74,964,513 (GRCm39) intron probably benign
R4701:Cfap65 UTSW 1 74,958,067 (GRCm39) missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74,967,520 (GRCm39) missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74,966,791 (GRCm39) missense probably benign 0.06
R4831:Cfap65 UTSW 1 74,956,454 (GRCm39) missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74,964,716 (GRCm39) missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74,958,420 (GRCm39) missense probably benign 0.00
R4881:Cfap65 UTSW 1 74,946,772 (GRCm39) missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74,942,283 (GRCm39) missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74,945,495 (GRCm39) nonsense probably null
R5074:Cfap65 UTSW 1 74,962,137 (GRCm39) missense probably benign 0.04
R5083:Cfap65 UTSW 1 74,945,600 (GRCm39) missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74,965,675 (GRCm39) missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74,964,061 (GRCm39) missense probably benign 0.07
R5333:Cfap65 UTSW 1 74,942,334 (GRCm39) missense probably benign 0.03
R5417:Cfap65 UTSW 1 74,964,259 (GRCm39) missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74,946,677 (GRCm39) intron probably benign
R5669:Cfap65 UTSW 1 74,964,127 (GRCm39) missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74,962,190 (GRCm39) missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74,959,564 (GRCm39) missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74,942,298 (GRCm39) missense probably benign 0.14
R6425:Cfap65 UTSW 1 74,966,868 (GRCm39) missense probably benign 0.00
R6677:Cfap65 UTSW 1 74,943,844 (GRCm39) missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74,956,445 (GRCm39) missense probably benign 0.00
R6838:Cfap65 UTSW 1 74,971,180 (GRCm39) missense probably benign 0.06
R6861:Cfap65 UTSW 1 74,964,274 (GRCm39) missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74,971,058 (GRCm39) missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74,965,792 (GRCm39) missense probably benign 0.01
R7320:Cfap65 UTSW 1 74,965,763 (GRCm39) missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74,960,742 (GRCm39) missense probably benign 0.07
R7426:Cfap65 UTSW 1 74,959,585 (GRCm39) missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74,965,769 (GRCm39) missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74,941,593 (GRCm39) missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74,972,303 (GRCm39) missense probably benign 0.44
R7704:Cfap65 UTSW 1 74,967,527 (GRCm39) missense probably benign 0.19
R7727:Cfap65 UTSW 1 74,965,784 (GRCm39) missense probably benign 0.00
R7895:Cfap65 UTSW 1 74,972,321 (GRCm39) missense probably benign 0.05
R8215:Cfap65 UTSW 1 74,949,902 (GRCm39) missense probably damaging 1.00
R8344:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8345:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8413:Cfap65 UTSW 1 74,956,328 (GRCm39) nonsense probably null
R8432:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8528:Cfap65 UTSW 1 74,945,096 (GRCm39) missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74,942,382 (GRCm39) missense probably benign 0.43
R8996:Cfap65 UTSW 1 74,941,347 (GRCm39) missense probably benign 0.11
R9020:Cfap65 UTSW 1 74,959,552 (GRCm39) missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74,943,847 (GRCm39) missense possibly damaging 0.88
R9127:Cfap65 UTSW 1 74,958,510 (GRCm39) splice site probably benign
R9187:Cfap65 UTSW 1 74,956,517 (GRCm39) missense probably benign 0.00
R9210:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9212:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9273:Cfap65 UTSW 1 74,960,769 (GRCm39) missense probably benign 0.00
R9454:Cfap65 UTSW 1 74,944,210 (GRCm39) missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74,945,468 (GRCm39) critical splice donor site probably null
R9595:Cfap65 UTSW 1 74,946,537 (GRCm39) missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74,958,501 (GRCm39) missense probably benign 0.16
R9742:Cfap65 UTSW 1 74,943,840 (GRCm39) missense probably benign 0.08
RF009:Cfap65 UTSW 1 74,944,806 (GRCm39) missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74,949,906 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGACCGTGTATCGTGTG -3'
(R):5'- ACTCCCTCACTCTTAGGGAC -3'

Sequencing Primer
(F):5'- TCTACCACTGGGAGGGATAGTC -3'
(R):5'- TCACTCTTAGGGACCTGCC -3'
Posted On 2020-10-20