Incidental Mutation 'R8431:Cfap65'
ID653727
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Namecilia and flagella associated protein 65
SynonymsCcdc108, B230363K08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R8431 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location74902071-74935599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74928044 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 249 (G249R)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
Predicted Effect probably benign
Transcript: ENSMUST00000094844
AA Change: G249R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: G249R

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 A G 8: 123,968,134 F273S Het
Abhd14b G T 9: 106,451,413 A78S probably benign Het
Adamtsl5 G A 10: 80,345,394 P51L probably benign Het
Adap1 A C 5: 139,273,425 F336V probably benign Het
Ankrd33b T C 15: 31,305,102 N172S probably damaging Het
Arhgap24 A G 5: 102,892,598 E560G possibly damaging Het
Ascc2 A T 11: 4,664,227 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
C130026I21Rik G A 1: 85,257,449 H130Y probably benign Het
Card6 A T 15: 5,100,276 F546Y probably damaging Het
Cby3 T G 11: 50,359,257 S2A probably damaging Het
Cct3 T C 3: 88,318,524 S385P possibly damaging Het
Cpne3 C A 4: 19,526,316 A408S probably damaging Het
Ctsr A C 13: 61,160,490 L280R probably damaging Het
D930048N14Rik GGG GGGG 11: 51,651,119 probably null Het
Dlg4 A G 11: 70,039,562 I388V probably benign Het
Ednrb T A 14: 103,843,197 I94F probably benign Het
Eftud2 C A 11: 102,846,236 A573S probably benign Het
Fsip2 C A 2: 82,981,566 P2743Q probably damaging Het
Gp2 C T 7: 119,442,787 C505Y probably benign Het
Ier5 C A 1: 155,098,560 D291Y probably benign Het
Ifi207 T C 1: 173,730,504 I223V unknown Het
Ifi208 T C 1: 173,683,278 V333A possibly damaging Het
Kank4 T C 4: 98,779,272 I313V probably benign Het
Klhl7 T C 5: 24,138,475 V263A possibly damaging Het
Klrg2 T C 6: 38,628,187 D314G probably benign Het
Lrr1 T C 12: 69,178,696 M382T possibly damaging Het
Ly6e A T 15: 74,958,341 Q48L probably benign Het
March6 C T 15: 31,505,746 W43* probably null Het
Mepe A G 5: 104,338,181 T396A possibly damaging Het
Myh8 T G 11: 67,283,614 L229R possibly damaging Het
Ndufa10 C G 1: 92,452,010 probably null Het
Nek1 C A 8: 61,034,032 A272E possibly damaging Het
Nr1h2 T C 7: 44,550,343 Y384C probably damaging Het
Olfr1223 C A 2: 89,144,379 V215F probably benign Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Phf2 A G 13: 48,821,602 F294S unknown Het
Polr3e A T 7: 120,931,305 I173F probably damaging Het
Ppfia2 A T 10: 106,836,091 R464* probably null Het
Ppp1r9a T A 6: 5,115,456 S860T probably benign Het
Rnf144a T C 12: 26,327,301 Y93C probably damaging Het
Ryr2 T C 13: 11,659,008 E3390G probably benign Het
Scn7a T C 2: 66,703,820 T504A possibly damaging Het
Slc26a5 T G 5: 21,813,906 D645A probably damaging Het
Ston2 T A 12: 91,648,297 I446F probably damaging Het
Tcp11l1 G A 2: 104,699,969 P57S probably damaging Het
Th G T 7: 142,893,064 H488Q probably benign Het
Tmprss4 A T 9: 45,184,363 I61N probably benign Het
Wdtc1 A G 4: 133,322,170 probably null Het
Xpnpep1 T C 19: 52,995,506 N596S probably benign Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74919183 critical splice donor site probably null
IGL01526:Cfap65 APN 1 74911078 missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74927194 missense probably benign
IGL01780:Cfap65 APN 1 74928348 nonsense probably null
IGL01993:Cfap65 APN 1 74920543 missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74928145 missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74928348 nonsense probably null
IGL02357:Cfap65 APN 1 74928348 nonsense probably null
IGL02576:Cfap65 APN 1 74903458 missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74905080 missense probably benign 0.00
IGL02792:Cfap65 APN 1 74927178 missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74911108 nonsense probably null
IGL03101:Cfap65 APN 1 74928433 missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74927619 missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74904642 missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74928342 missense probably benign 0.05
R0077:Cfap65 UTSW 1 74931918 missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74931958 nonsense probably null
R0281:Cfap65 UTSW 1 74927071 missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74904067 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929301 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929302 missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74926444 missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74920601 missense probably benign 0.00
R0361:Cfap65 UTSW 1 74925440 missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74916884 missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74918444 missense probably benign 0.01
R0646:Cfap65 UTSW 1 74902169 missense probably benign 0.09
R0734:Cfap65 UTSW 1 74918887 missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74904682 missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74921519 missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74902447 missense probably damaging 0.98
R1079:Cfap65 UTSW 1 74905713 missense probably damaging 0.99
R1083:Cfap65 UTSW 1 74918504 splice site probably benign
R1159:Cfap65 UTSW 1 74929340 missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74925104 missense probably benign 0.03
R1644:Cfap65 UTSW 1 74917175 missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74918948 missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74907660 missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74917199 missense probably benign 0.30
R2132:Cfap65 UTSW 1 74907691 missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74917273 frame shift probably null
R2219:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74926475 missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74927186 small insertion probably benign
R3114:Cfap65 UTSW 1 74927132 missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74920542 missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74927681 missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74903358 missense probably benign 0.17
R4547:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74904056 missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74925354 intron probably benign
R4701:Cfap65 UTSW 1 74918908 missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74928361 missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74927632 missense probably benign 0.06
R4831:Cfap65 UTSW 1 74917295 missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74925557 missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74919261 missense probably benign 0.00
R4881:Cfap65 UTSW 1 74907613 missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74903124 missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74906336 nonsense probably null
R5074:Cfap65 UTSW 1 74922978 missense probably benign 0.04
R5083:Cfap65 UTSW 1 74906441 missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74926516 missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74924902 missense probably benign 0.07
R5333:Cfap65 UTSW 1 74903175 missense probably benign 0.03
R5417:Cfap65 UTSW 1 74925100 missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74907518 intron probably benign
R5669:Cfap65 UTSW 1 74924968 missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74923031 missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74920405 missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74903139 missense probably benign 0.14
R6425:Cfap65 UTSW 1 74927709 missense probably benign 0.00
R6677:Cfap65 UTSW 1 74904685 missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74917286 missense probably benign 0.00
R6838:Cfap65 UTSW 1 74932021 missense probably benign 0.06
R6861:Cfap65 UTSW 1 74925115 missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74931899 missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74926633 missense probably benign 0.01
R7320:Cfap65 UTSW 1 74926604 missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74921583 missense probably benign 0.07
R7426:Cfap65 UTSW 1 74920426 missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74926610 missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74902434 missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74933144 missense probably benign 0.44
R7704:Cfap65 UTSW 1 74928368 missense probably benign 0.19
R7727:Cfap65 UTSW 1 74926625 missense probably benign 0.00
R7895:Cfap65 UTSW 1 74933162 missense probably benign 0.05
R8344:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8345:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8413:Cfap65 UTSW 1 74917169 nonsense probably null
R8432:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8528:Cfap65 UTSW 1 74905937 missense possibly damaging 0.88
RF009:Cfap65 UTSW 1 74905647 missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74910747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGACCGTGTATCGTGTG -3'
(R):5'- ACTCCCTCACTCTTAGGGAC -3'

Sequencing Primer
(F):5'- TCTACCACTGGGAGGGATAGTC -3'
(R):5'- TCACTCTTAGGGACCTGCC -3'
Posted On2020-10-20