Mutagenetix > Incidental Mutations

Incidental Mutation 'R8431:Kank4'

653739

Institutional Source

Beutler Lab

Gene Symbol

Kank4

Ensembl Gene

ENSMUSG00000035407

Gene Name

KN motif and ankyrin repeat domains 4

Synonyms

Ankrd38

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.058) question?

Stock #

R8431 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

98754898-98817537 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 98779272 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 313 (I313V)

Ref Sequence

ENSEMBL: ENSMUSP00000099851 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102790]

Predicted Effect

probably benign
Transcript: ENSMUST00000102790
AA Change: I313V

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000099851
Gene: ENSMUSG00000035407
AA Change: I313V

Domain	Start	End	E-Value	Type
Pfam:KN_motif	24	62	5.6e-26	PFAM
low complexity region	280	295	N/A	INTRINSIC
low complexity region	300	320	N/A	INTRINSIC
coiled coil region	345	409	N/A	INTRINSIC
low complexity region	505	521	N/A	INTRINSIC
low complexity region	600	624	N/A	INTRINSIC
low complexity region	625	655	N/A	INTRINSIC
low complexity region	685	709	N/A	INTRINSIC
ANK	838	868	7.42e-4	SMART
ANK	877	905	2.08e3	SMART
ANK	910	939	1.11e-2	SMART
ANK	943	973	8.99e-3	SMART
ANK	977	1006	2.43e3	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb10	A	G	8: 123,968,134	F273S		Het
Abhd14b	G	T	9: 106,451,413	A78S	probably benign	Het
Adamtsl5	G	A	10: 80,345,394	P51L	probably benign	Het
Adap1	A	C	5: 139,273,425	F336V	probably benign	Het
Ankrd33b	T	C	15: 31,305,102	N172S	probably damaging	Het
Arhgap24	A	G	5: 102,892,598	E560G	possibly damaging	Het
Ascc2	A	T	11: 4,664,227		probably null	Het
Bhlhe40	TG	TGG	6: 108,664,857		probably null	Het
C130026I21Rik	G	A	1: 85,257,449	H130Y	probably benign	Het
Card6	A	T	15: 5,100,276	F546Y	probably damaging	Het
Cby3	T	G	11: 50,359,257	S2A	probably damaging	Het
Cct3	T	C	3: 88,318,524	S385P	possibly damaging	Het
Cfap65	C	T	1: 74,928,044	G249R	probably benign	Het
Cpne3	C	A	4: 19,526,316	A408S	probably damaging	Het
Ctsr	A	C	13: 61,160,490	L280R	probably damaging	Het
D930048N14Rik	GGG	GGGG	11: 51,651,119		probably null	Het
Dlg4	A	G	11: 70,039,562	I388V	probably benign	Het
Ednrb	T	A	14: 103,843,197	I94F	probably benign	Het
Eftud2	C	A	11: 102,846,236	A573S	probably benign	Het
Fsip2	C	A	2: 82,981,566	P2743Q	probably damaging	Het
Gp2	C	T	7: 119,442,787	C505Y	probably benign	Het
Ier5	C	A	1: 155,098,560	D291Y	probably benign	Het
Ifi207	T	C	1: 173,730,504	I223V	unknown	Het
Ifi208	T	C	1: 173,683,278	V333A	possibly damaging	Het
Klhl7	T	C	5: 24,138,475	V263A	possibly damaging	Het
Klrg2	T	C	6: 38,628,187	D314G	probably benign	Het
Lrr1	T	C	12: 69,178,696	M382T	possibly damaging	Het
Ly6e	A	T	15: 74,958,341	Q48L	probably benign	Het
March6	C	T	15: 31,505,746	W43*	probably null	Het
Mepe	A	G	5: 104,338,181	T396A	possibly damaging	Het
Myh8	T	G	11: 67,283,614	L229R	possibly damaging	Het
Ndufa10	C	G	1: 92,452,010		probably null	Het
Nek1	C	A	8: 61,034,032	A272E	possibly damaging	Het
Nr1h2	T	C	7: 44,550,343	Y384C	probably damaging	Het
Olfr1223	C	A	2: 89,144,379	V215F	probably benign	Het
Pcnx3	C	T	19: 5,665,384	G1946E	probably damaging	Het
Phf2	A	G	13: 48,821,602	F294S	unknown	Het
Polr3e	A	T	7: 120,931,305	I173F	probably damaging	Het
Ppfia2	A	T	10: 106,836,091	R464*	probably null	Het
Ppp1r9a	T	A	6: 5,115,456	S860T	probably benign	Het
Rnf144a	T	C	12: 26,327,301	Y93C	probably damaging	Het
Ryr2	T	C	13: 11,659,008	E3390G	probably benign	Het
Scn7a	T	C	2: 66,703,820	T504A	possibly damaging	Het
Slc26a5	T	G	5: 21,813,906	D645A	probably damaging	Het
Ston2	T	A	12: 91,648,297	I446F	probably damaging	Het
Tcp11l1	G	A	2: 104,699,969	P57S	probably damaging	Het
Th	G	T	7: 142,893,064	H488Q	probably benign	Het
Tmprss4	A	T	9: 45,184,363	I61N	probably benign	Het
Wdtc1	A	G	4: 133,322,170		probably null	Het
Xpnpep1	T	C	19: 52,995,506	N596S	probably benign	Het

Other mutations in Kank4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01069:Kank4	APN	4	98778395	missense	probably damaging	0.99
IGL02634:Kank4	APN	4	98778827	missense	probably benign	0.06
IGL02883:Kank4	APN	4	98773453	missense	possibly damaging	0.87
R0040:Kank4	UTSW	4	98779220	missense	probably benign	0.03
R0040:Kank4	UTSW	4	98779220	missense	probably benign	0.03
R0081:Kank4	UTSW	4	98778330	missense	probably benign	0.02
R0219:Kank4	UTSW	4	98778465	missense	probably benign	0.06
R0498:Kank4	UTSW	4	98779636	missense	probably benign
R0609:Kank4	UTSW	4	98777105	missense	probably damaging	0.99
R0855:Kank4	UTSW	4	98771444	missense	probably damaging	1.00
R0865:Kank4	UTSW	4	98774663	splice site	probably benign
R0961:Kank4	UTSW	4	98756519	missense	probably benign	0.02
R1172:Kank4	UTSW	4	98765569	missense	probably damaging	1.00
R1173:Kank4	UTSW	4	98765569	missense	probably damaging	1.00
R1175:Kank4	UTSW	4	98765569	missense	probably damaging	1.00
R1381:Kank4	UTSW	4	98779938	missense	probably damaging	0.98
R1517:Kank4	UTSW	4	98779029	missense	possibly damaging	0.83
R1573:Kank4	UTSW	4	98774836	nonsense	probably null
R1668:Kank4	UTSW	4	98778896	missense	probably damaging	0.98
R2051:Kank4	UTSW	4	98780102	missense	probably damaging	0.99
R2253:Kank4	UTSW	4	98779226	missense	probably damaging	0.99
R2656:Kank4	UTSW	4	98778957	missense	probably damaging	0.99
R3801:Kank4	UTSW	4	98780133	missense	probably damaging	0.97
R3802:Kank4	UTSW	4	98780133	missense	probably damaging	0.97
R3804:Kank4	UTSW	4	98780133	missense	probably damaging	0.97
R3945:Kank4	UTSW	4	98771280	missense	probably damaging	1.00
R4172:Kank4	UTSW	4	98779121	missense	probably damaging	1.00
R4502:Kank4	UTSW	4	98777098	missense	possibly damaging	0.89
R4503:Kank4	UTSW	4	98777098	missense	possibly damaging	0.89
R5024:Kank4	UTSW	4	98785661	missense	probably damaging	0.99
R5105:Kank4	UTSW	4	98779159	missense	probably benign	0.01
R5122:Kank4	UTSW	4	98756567	missense	probably damaging	1.00
R5255:Kank4	UTSW	4	98778972	missense	probably benign
R5484:Kank4	UTSW	4	98774785	missense	probably benign
R5517:Kank4	UTSW	4	98774881	missense	probably damaging	1.00
R5550:Kank4	UTSW	4	98771441	missense	probably benign	0.27
R5667:Kank4	UTSW	4	98765461	critical splice donor site	probably null
R5671:Kank4	UTSW	4	98765461	critical splice donor site	probably null
R5865:Kank4	UTSW	4	98771393	missense	possibly damaging	0.50
R6176:Kank4	UTSW	4	98765554	missense	probably damaging	1.00
R6778:Kank4	UTSW	4	98761505	missense	probably benign	0.01
R7084:Kank4	UTSW	4	98771345	missense	probably damaging	1.00
R7085:Kank4	UTSW	4	98779946	missense	probably benign
R7112:Kank4	UTSW	4	98761521	missense	probably damaging	0.99
R8307:Kank4	UTSW	4	98778678	nonsense	probably null
R8447:Kank4	UTSW	4	98778492	missense	probably damaging	0.99
R8505:Kank4	UTSW	4	98785676	start gained	probably benign
X0027:Kank4	UTSW	4	98779923	missense	probably benign	0.00
Z1176:Kank4	UTSW	4	98778294	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TTCTTCCTGCTGCTCAAGGG -3'
(R):5'- TCAAGTCACCTCTCTCAGCCAG -3'

Sequencing Primer
(F):5'- TGCTCAAGGGCAGCTCTGAC -3'
(R):5'- AGGTCCTTCCTCCGCAG -3'

Posted On

2020-10-20