Incidental Mutation 'R8431:Arhgap24'
ID653743
Institutional Source Beutler Lab
Gene Symbol Arhgap24
Ensembl Gene ENSMUSG00000057315
Gene NameRho GTPase activating protein 24
Synonyms0610025G21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8431 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location102481391-102897937 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102892598 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 560 (E560G)
Ref Sequence ENSEMBL: ENSMUSP00000092138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070000] [ENSMUST00000073302] [ENSMUST00000094559] [ENSMUST00000112852] [ENSMUST00000112853] [ENSMUST00000112854]
Predicted Effect probably damaging
Transcript: ENSMUST00000070000
AA Change: E470G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070048
Gene: ENSMUSG00000057315
AA Change: E470G

DomainStartEndE-ValueType
RhoGAP 58 234 7.04e-67 SMART
low complexity region 476 487 N/A INTRINSIC
low complexity region 520 539 N/A INTRINSIC
coiled coil region 558 638 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000073302
AA Change: E467G

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073028
Gene: ENSMUSG00000057315
AA Change: E467G

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000094559
AA Change: E560G

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092138
Gene: ENSMUSG00000057315
AA Change: E560G

DomainStartEndE-ValueType
PH 18 125 5.35e-23 SMART
RhoGAP 148 324 7.04e-67 SMART
low complexity region 566 577 N/A INTRINSIC
low complexity region 610 629 N/A INTRINSIC
coiled coil region 648 728 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112852
AA Change: E467G

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108473
Gene: ENSMUSG00000057315
AA Change: E467G

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112853
AA Change: E467G

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108474
Gene: ENSMUSG00000057315
AA Change: E467G

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112854
AA Change: E467G

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108475
Gene: ENSMUSG00000057315
AA Change: E467G

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Rho-GTPase activating protein, which is specific for the small GTPase family member Rac. Binding of the encoded protein by filamin A targets it to sites of membrane protrusion, where it antognizes Rac. This results in suppression of lamellae formation and promotion of retraction to regulate cell polarity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 A G 8: 123,968,134 F273S Het
Abhd14b G T 9: 106,451,413 A78S probably benign Het
Adamtsl5 G A 10: 80,345,394 P51L probably benign Het
Adap1 A C 5: 139,273,425 F336V probably benign Het
Ankrd33b T C 15: 31,305,102 N172S probably damaging Het
Ascc2 A T 11: 4,664,227 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
C130026I21Rik G A 1: 85,257,449 H130Y probably benign Het
Card6 A T 15: 5,100,276 F546Y probably damaging Het
Cby3 T G 11: 50,359,257 S2A probably damaging Het
Cct3 T C 3: 88,318,524 S385P possibly damaging Het
Cfap65 C T 1: 74,928,044 G249R probably benign Het
Cpne3 C A 4: 19,526,316 A408S probably damaging Het
Ctsr A C 13: 61,160,490 L280R probably damaging Het
D930048N14Rik GGG GGGG 11: 51,651,119 probably null Het
Dlg4 A G 11: 70,039,562 I388V probably benign Het
Ednrb T A 14: 103,843,197 I94F probably benign Het
Eftud2 C A 11: 102,846,236 A573S probably benign Het
Fsip2 C A 2: 82,981,566 P2743Q probably damaging Het
Gp2 C T 7: 119,442,787 C505Y probably benign Het
Ier5 C A 1: 155,098,560 D291Y probably benign Het
Ifi207 T C 1: 173,730,504 I223V unknown Het
Ifi208 T C 1: 173,683,278 V333A possibly damaging Het
Kank4 T C 4: 98,779,272 I313V probably benign Het
Klhl7 T C 5: 24,138,475 V263A possibly damaging Het
Klrg2 T C 6: 38,628,187 D314G probably benign Het
Lrr1 T C 12: 69,178,696 M382T possibly damaging Het
Ly6e A T 15: 74,958,341 Q48L probably benign Het
March6 C T 15: 31,505,746 W43* probably null Het
Mepe A G 5: 104,338,181 T396A possibly damaging Het
Myh8 T G 11: 67,283,614 L229R possibly damaging Het
Ndufa10 C G 1: 92,452,010 probably null Het
Nek1 C A 8: 61,034,032 A272E possibly damaging Het
Nr1h2 T C 7: 44,550,343 Y384C probably damaging Het
Olfr1223 C A 2: 89,144,379 V215F probably benign Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Phf2 A G 13: 48,821,602 F294S unknown Het
Polr3e A T 7: 120,931,305 I173F probably damaging Het
Ppfia2 A T 10: 106,836,091 R464* probably null Het
Ppp1r9a T A 6: 5,115,456 S860T probably benign Het
Rnf144a T C 12: 26,327,301 Y93C probably damaging Het
Ryr2 T C 13: 11,659,008 E3390G probably benign Het
Scn7a T C 2: 66,703,820 T504A possibly damaging Het
Slc26a5 T G 5: 21,813,906 D645A probably damaging Het
Ston2 T A 12: 91,648,297 I446F probably damaging Het
Tcp11l1 G A 2: 104,699,969 P57S probably damaging Het
Th G T 7: 142,893,064 H488Q probably benign Het
Tmprss4 A T 9: 45,184,363 I61N probably benign Het
Wdtc1 A G 4: 133,322,170 probably null Het
Xpnpep1 T C 19: 52,995,506 N596S probably benign Het
Other mutations in Arhgap24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Arhgap24 APN 5 102860399 missense possibly damaging 0.94
IGL01483:Arhgap24 APN 5 102860377 missense possibly damaging 0.91
IGL02641:Arhgap24 APN 5 102892520 missense probably damaging 1.00
IGL03166:Arhgap24 APN 5 102875686 splice site probably benign
bullmarket UTSW 5 102875777 missense probably damaging 0.99
buyers UTSW 5 102897220 missense probably damaging 1.00
wallstreet UTSW 5 102552297 splice site probably null
BB009:Arhgap24 UTSW 5 102845969 intron probably benign
BB019:Arhgap24 UTSW 5 102845969 intron probably benign
R0506:Arhgap24 UTSW 5 102875777 missense probably damaging 0.99
R0606:Arhgap24 UTSW 5 102897220 missense probably damaging 1.00
R1457:Arhgap24 UTSW 5 102664106 missense probably damaging 0.98
R1491:Arhgap24 UTSW 5 102860332 missense possibly damaging 0.47
R1707:Arhgap24 UTSW 5 102892087 missense probably benign 0.40
R2112:Arhgap24 UTSW 5 102892500 missense probably damaging 1.00
R2300:Arhgap24 UTSW 5 102860425 missense probably damaging 1.00
R2516:Arhgap24 UTSW 5 102891910 missense probably benign
R3803:Arhgap24 UTSW 5 102892442 missense probably damaging 0.98
R4257:Arhgap24 UTSW 5 102664117 missense probably benign 0.00
R4761:Arhgap24 UTSW 5 102664214 intron probably benign
R5045:Arhgap24 UTSW 5 102891877 missense possibly damaging 0.79
R5121:Arhgap24 UTSW 5 102841335 missense probably damaging 1.00
R5209:Arhgap24 UTSW 5 102892149 missense probably benign 0.12
R5667:Arhgap24 UTSW 5 102846171 critical splice donor site probably null
R5914:Arhgap24 UTSW 5 102552159 splice site probably null
R6039:Arhgap24 UTSW 5 102880786 missense probably damaging 0.98
R6039:Arhgap24 UTSW 5 102880786 missense probably damaging 0.98
R6158:Arhgap24 UTSW 5 102892912 missense probably benign 0.12
R6410:Arhgap24 UTSW 5 102892151 missense probably benign 0.10
R6450:Arhgap24 UTSW 5 102897124 missense probably benign 0.01
R6520:Arhgap24 UTSW 5 102880793 missense probably benign 0.00
R6666:Arhgap24 UTSW 5 102552297 splice site probably null
R7233:Arhgap24 UTSW 5 102878501 missense probably benign 0.03
R7311:Arhgap24 UTSW 5 102892685 missense probably damaging 1.00
R7460:Arhgap24 UTSW 5 102892346 missense probably benign 0.36
R7483:Arhgap24 UTSW 5 102841308 missense probably benign 0.13
R7515:Arhgap24 UTSW 5 102846016 intron probably benign
R7667:Arhgap24 UTSW 5 102878457 missense probably benign
R7932:Arhgap24 UTSW 5 102845969 intron probably benign
R8227:Arhgap24 UTSW 5 102875781 missense probably benign 0.02
R8289:Arhgap24 UTSW 5 102880826 missense possibly damaging 0.88
R8721:Arhgap24 UTSW 5 102875699 missense possibly damaging 0.46
R8767:Arhgap24 UTSW 5 102891874 missense probably benign
Z1176:Arhgap24 UTSW 5 102875759 missense probably damaging 0.97
Z1176:Arhgap24 UTSW 5 102880807 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATTCCTTGAACGGCCGGAG -3'
(R):5'- AATGTCTCGCTGTTATCGCTGC -3'

Sequencing Primer
(F):5'- AGCATGAGTTGGCTGCC -3'
(R):5'- ATCGCTGCTGCTCGTGG -3'
Posted On2020-10-20