Incidental Mutation 'R0350:Nuf2'
ID65376
Institutional Source Beutler Lab
Gene Symbol Nuf2
Ensembl Gene ENSMUSG00000026683
Gene NameNUF2, NDC80 kinetochore complex component
SynonymsNuf2R, Cdca1, 2410003C07Rik
MMRRC Submission 038557-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R0350 (G1)
Quality Score95
Status Not validated
Chromosome1
Chromosomal Location169497934-169531464 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 169513543 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028000] [ENSMUST00000028000] [ENSMUST00000111368] [ENSMUST00000111368] [ENSMUST00000192248] [ENSMUST00000192248]
Predicted Effect probably null
Transcript: ENSMUST00000028000
SMART Domains Protein: ENSMUSP00000028000
Gene: ENSMUSG00000026683

DomainStartEndE-ValueType
Pfam:Nuf2 1 149 9.7e-46 PFAM
coiled coil region 174 227 N/A INTRINSIC
coiled coil region 290 343 N/A INTRINSIC
coiled coil region 389 462 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000028000
SMART Domains Protein: ENSMUSP00000028000
Gene: ENSMUSG00000026683

DomainStartEndE-ValueType
Pfam:Nuf2 1 149 9.7e-46 PFAM
coiled coil region 174 227 N/A INTRINSIC
coiled coil region 290 343 N/A INTRINSIC
coiled coil region 389 462 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111368
SMART Domains Protein: ENSMUSP00000106999
Gene: ENSMUSG00000026683

DomainStartEndE-ValueType
Pfam:Nuf2 3 146 6.5e-37 PFAM
coiled coil region 174 227 N/A INTRINSIC
coiled coil region 290 343 N/A INTRINSIC
coiled coil region 389 462 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111368
SMART Domains Protein: ENSMUSP00000106999
Gene: ENSMUSG00000026683

DomainStartEndE-ValueType
Pfam:Nuf2 3 146 6.5e-37 PFAM
coiled coil region 174 227 N/A INTRINSIC
coiled coil region 290 343 N/A INTRINSIC
coiled coil region 389 462 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000192248
SMART Domains Protein: ENSMUSP00000141427
Gene: ENSMUSG00000026683

DomainStartEndE-ValueType
Pfam:Nuf2 1 149 2.3e-43 PFAM
SCOP:d1ab4__ 154 210 9e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000192248
SMART Domains Protein: ENSMUSP00000141427
Gene: ENSMUSG00000026683

DomainStartEndE-ValueType
Pfam:Nuf2 1 149 2.3e-43 PFAM
SCOP:d1ab4__ 154 210 9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195342
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly similar to yeast Nuf2, a component of a conserved protein complex associated with the centromere. Yeast Nuf2 disappears from the centromere during meiotic prophase when centromeres lose their connection to the spindle pole body, and plays a regulatory role in chromosome segregation. The encoded protein is found to be associated with centromeres of mitotic HeLa cells, which suggests that this protein is a functional homolog of yeast Nuf2. Alternatively spliced transcript variants that encode the same protein have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T A 8: 9,987,600 Y66N probably damaging Het
Apol6 C T 15: 77,050,947 Q139* probably null Het
Armh1 C A 4: 117,215,556 E244* probably null Het
BC052040 T C 2: 115,776,930 Y255H possibly damaging Het
Ccdc130 C T 8: 84,260,648 E99K probably damaging Het
Cd1d1 A T 3: 86,997,573 H219Q probably benign Het
Cdca2 A G 14: 67,713,119 L121P probably benign Het
Cog4 T A 8: 110,853,696 L133I possibly damaging Het
Csf1 T C 3: 107,748,606 M370V probably benign Het
Ddi2 G A 4: 141,685,523 T26M probably benign Het
Dhcr7 A G 7: 143,837,770 D32G probably damaging Het
Exd1 T C 2: 119,523,566 N337S possibly damaging Het
Flii T C 11: 60,721,857 D227G probably damaging Het
Gm11639 T C 11: 104,690,880 V16A probably benign Het
Hsf1 A G 15: 76,500,479 T485A probably benign Het
Igfn1 G A 1: 135,956,767 R2614* probably null Het
Iqch T C 9: 63,500,876 T630A probably benign Het
Itgal T A 7: 127,322,081 D770E probably damaging Het
Mroh1 T A 15: 76,432,249 V759E probably damaging Het
Mrps17 A G 5: 129,718,145 probably benign Het
Mtpap A G 18: 4,396,195 S496G possibly damaging Het
Nkd1 T A 8: 88,585,216 Y39* probably null Het
Nmd3 A G 3: 69,743,574 Y359C probably damaging Het
Nr1h3 G A 2: 91,191,825 L153F possibly damaging Het
Olfr1218 T A 2: 89,055,356 K23N probably benign Het
Olfr1272 T C 2: 90,282,582 probably null Het
Olfr870 A T 9: 20,170,736 Y278* probably null Het
Pnn T C 12: 59,067,117 probably null Het
Ppm1j A G 3: 104,783,371 D230G probably benign Het
Ppp1r15a A T 7: 45,523,018 L650Q probably damaging Het
Prss37 T C 6: 40,514,959 E229G probably damaging Het
Rbm19 T C 5: 120,128,307 V465A possibly damaging Het
Rubcnl G T 14: 75,040,891 V372F probably damaging Het
Sema6a G T 18: 47,270,718 D595E probably benign Het
Slc35c1 A G 2: 92,459,032 F43S probably damaging Het
Slc39a5 C T 10: 128,396,750 probably null Het
Slco4c1 A G 1: 96,828,849 F583L probably benign Het
Sox9 A G 11: 112,784,876 Y297C probably damaging Het
Taf1b A G 12: 24,514,885 D167G possibly damaging Het
Trpm6 T C 19: 18,883,957 probably null Het
Uba6 A C 5: 86,144,378 V402G possibly damaging Het
Usp43 T C 11: 67,876,498 Y682C probably damaging Het
Vmn1r195 A G 13: 22,279,233 D291G probably damaging Het
Xpr1 A T 1: 155,330,468 F156Y probably damaging Het
Zfp318 T A 17: 46,413,198 H2042Q probably benign Het
Zfp937 T A 2: 150,239,302 D417E possibly damaging Het
Other mutations in Nuf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00707:Nuf2 APN 1 169522435 unclassified probably benign
IGL00980:Nuf2 APN 1 169510434 missense probably damaging 1.00
IGL01131:Nuf2 APN 1 169522364 splice site probably benign
IGL01310:Nuf2 APN 1 169498862 missense probably benign 0.12
IGL01774:Nuf2 APN 1 169506072 missense probably benign
IGL01786:Nuf2 APN 1 169510483 missense possibly damaging 0.88
IGL01866:Nuf2 APN 1 169498838 missense possibly damaging 0.68
IGL02134:Nuf2 APN 1 169513500 missense probably benign
IGL02955:Nuf2 APN 1 169507238 splice site probably benign
R0390:Nuf2 UTSW 1 169525297 unclassified probably benign
R0479:Nuf2 UTSW 1 169498934 splice site probably benign
R0578:Nuf2 UTSW 1 169510549 splice site probably benign
R0765:Nuf2 UTSW 1 169522936 unclassified probably benign
R1351:Nuf2 UTSW 1 169510549 splice site probably benign
R1564:Nuf2 UTSW 1 169498793 missense unknown
R3747:Nuf2 UTSW 1 169525376 missense probably damaging 1.00
R3748:Nuf2 UTSW 1 169525376 missense probably damaging 1.00
R3749:Nuf2 UTSW 1 169525376 missense probably damaging 1.00
R4601:Nuf2 UTSW 1 169506114 missense probably damaging 1.00
R4815:Nuf2 UTSW 1 169510468 missense probably damaging 1.00
R5473:Nuf2 UTSW 1 169507287 missense probably benign 0.05
R5522:Nuf2 UTSW 1 169498884 missense probably damaging 1.00
R5716:Nuf2 UTSW 1 169522389 missense probably benign 0.23
R5742:Nuf2 UTSW 1 169516622 missense probably damaging 1.00
R6583:Nuf2 UTSW 1 169504548 missense probably benign
R6680:Nuf2 UTSW 1 169515009 splice site probably null
R7068:Nuf2 UTSW 1 169522419 missense probably damaging 1.00
R7099:Nuf2 UTSW 1 169506072 missense probably benign
R7186:Nuf2 UTSW 1 169525385 missense probably damaging 0.99
R7527:Nuf2 UTSW 1 169498853 missense possibly damaging 0.55
R7578:Nuf2 UTSW 1 169504528 missense probably benign 0.00
R7836:Nuf2 UTSW 1 169525329 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAATGCACACAGCACTGGCAG -3'
(R):5'- TCAGAAACAAGGCATCAACTCGGAG -3'

Sequencing Primer
(F):5'- GCCACATACTGTTTCTTTAGCAAGG -3'
(R):5'- tccttccttccttccttccc -3'
Posted On2013-08-08