Incidental Mutation 'R8431:Ctsr'
ID653770
Institutional Source Beutler Lab
Gene Symbol Ctsr
Ensembl Gene ENSMUSG00000055679
Gene Namecathepsin R
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R8431 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location61159204-61164256 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 61160490 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 280 (L280R)
Ref Sequence ENSEMBL: ENSMUSP00000021889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021889]
Predicted Effect probably damaging
Transcript: ENSMUST00000021889
AA Change: L280R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021889
Gene: ENSMUSG00000055679
AA Change: L280R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Inhibitor_I29 29 88 1.68e-21 SMART
Pept_C1 115 333 1.59e-111 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 A G 8: 123,968,134 F273S Het
Abhd14b G T 9: 106,451,413 A78S probably benign Het
Adamtsl5 G A 10: 80,345,394 P51L probably benign Het
Adap1 A C 5: 139,273,425 F336V probably benign Het
Ankrd33b T C 15: 31,305,102 N172S probably damaging Het
Arhgap24 A G 5: 102,892,598 E560G possibly damaging Het
Ascc2 A T 11: 4,664,227 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
C130026I21Rik G A 1: 85,257,449 H130Y probably benign Het
Card6 A T 15: 5,100,276 F546Y probably damaging Het
Cby3 T G 11: 50,359,257 S2A probably damaging Het
Cct3 T C 3: 88,318,524 S385P possibly damaging Het
Cfap65 C T 1: 74,928,044 G249R probably benign Het
Cpne3 C A 4: 19,526,316 A408S probably damaging Het
D930048N14Rik GGG GGGG 11: 51,651,119 probably null Het
Dlg4 A G 11: 70,039,562 I388V probably benign Het
Ednrb T A 14: 103,843,197 I94F probably benign Het
Eftud2 C A 11: 102,846,236 A573S probably benign Het
Fsip2 C A 2: 82,981,566 P2743Q probably damaging Het
Gp2 C T 7: 119,442,787 C505Y probably benign Het
Ier5 C A 1: 155,098,560 D291Y probably benign Het
Ifi207 T C 1: 173,730,504 I223V unknown Het
Ifi208 T C 1: 173,683,278 V333A possibly damaging Het
Kank4 T C 4: 98,779,272 I313V probably benign Het
Klhl7 T C 5: 24,138,475 V263A possibly damaging Het
Klrg2 T C 6: 38,628,187 D314G probably benign Het
Lrr1 T C 12: 69,178,696 M382T possibly damaging Het
Ly6e A T 15: 74,958,341 Q48L probably benign Het
March6 C T 15: 31,505,746 W43* probably null Het
Mepe A G 5: 104,338,181 T396A possibly damaging Het
Myh8 T G 11: 67,283,614 L229R possibly damaging Het
Ndufa10 C G 1: 92,452,010 probably null Het
Nek1 C A 8: 61,034,032 A272E possibly damaging Het
Nr1h2 T C 7: 44,550,343 Y384C probably damaging Het
Olfr1223 C A 2: 89,144,379 V215F probably benign Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Phf2 A G 13: 48,821,602 F294S unknown Het
Polr3e A T 7: 120,931,305 I173F probably damaging Het
Ppfia2 A T 10: 106,836,091 R464* probably null Het
Ppp1r9a T A 6: 5,115,456 S860T probably benign Het
Rnf144a T C 12: 26,327,301 Y93C probably damaging Het
Ryr2 T C 13: 11,659,008 E3390G probably benign Het
Scn7a T C 2: 66,703,820 T504A possibly damaging Het
Slc26a5 T G 5: 21,813,906 D645A probably damaging Het
Ston2 T A 12: 91,648,297 I446F probably damaging Het
Tcp11l1 G A 2: 104,699,969 P57S probably damaging Het
Th G T 7: 142,893,064 H488Q probably benign Het
Tmprss4 A T 9: 45,184,363 I61N probably benign Het
Wdtc1 A G 4: 133,322,170 probably null Het
Xpnpep1 T C 19: 52,995,506 N596S probably benign Het
Other mutations in Ctsr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00647:Ctsr APN 13 61162742 missense probably damaging 1.00
IGL01327:Ctsr APN 13 61162675 splice site probably benign
IGL02169:Ctsr APN 13 61163240 splice site probably benign
IGL02516:Ctsr APN 13 61163178 missense probably benign
IGL02739:Ctsr APN 13 61161844 missense probably benign 0.01
PIT4687001:Ctsr UTSW 13 61160532 missense possibly damaging 0.52
R0180:Ctsr UTSW 13 61162745 missense probably damaging 1.00
R1938:Ctsr UTSW 13 61162445 missense probably benign 0.00
R2362:Ctsr UTSW 13 61162796 missense probably damaging 1.00
R3856:Ctsr UTSW 13 61161936 missense possibly damaging 0.75
R4125:Ctsr UTSW 13 61161845 missense probably benign 0.17
R4135:Ctsr UTSW 13 61161270 missense probably benign 0.15
R4903:Ctsr UTSW 13 61163131 missense probably benign 0.01
R5551:Ctsr UTSW 13 61159543 missense probably damaging 1.00
R5705:Ctsr UTSW 13 61161264 missense probably damaging 1.00
R5721:Ctsr UTSW 13 61161853 missense possibly damaging 0.84
R6132:Ctsr UTSW 13 61161768 critical splice donor site probably null
R6196:Ctsr UTSW 13 61160531 missense probably benign 0.09
R6719:Ctsr UTSW 13 61160451 missense possibly damaging 0.60
R7530:Ctsr UTSW 13 61163117 missense probably damaging 1.00
R7698:Ctsr UTSW 13 61162567 missense probably benign 0.01
R7963:Ctsr UTSW 13 61162462 missense probably damaging 1.00
R8251:Ctsr UTSW 13 61162778 missense probably damaging 1.00
R8810:Ctsr UTSW 13 61161825 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGACTTGCAACAGGAAAATTC -3'
(R):5'- GCACATAGACAAGTGTTTACCAAC -3'

Sequencing Primer
(F):5'- GGAAAATTCCTTCACTAATCCCCCTG -3'
(R):5'- AGACAAGTGTTTACCAACAAATAAAC -3'
Posted On2020-10-20