Incidental Mutation 'R8431:Card6'
ID653772
Institutional Source Beutler Lab
Gene Symbol Card6
Ensembl Gene ENSMUSG00000041849
Gene Namecaspase recruitment domain family, member 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8431 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location5095981-5108539 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5100276 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 546 (F546Y)
Ref Sequence ENSEMBL: ENSMUSP00000112833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118365] [ENSMUST00000141020]
Predicted Effect probably damaging
Transcript: ENSMUST00000118365
AA Change: F546Y

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112833
Gene: ENSMUSG00000041849
AA Change: F546Y

DomainStartEndE-ValueType
CARD 3 89 2.13e-5 SMART
low complexity region 237 245 N/A INTRINSIC
low complexity region 257 273 N/A INTRINSIC
Blast:PGAM 278 656 7e-45 BLAST
low complexity region 919 935 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
internal_repeat_1 962 1041 6.5e-13 PROSPERO
internal_repeat_1 1039 1101 6.5e-13 PROSPERO
low complexity region 1107 1132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141020
SMART Domains Protein: ENSMUSP00000118817
Gene: ENSMUSG00000041849

DomainStartEndE-ValueType
CARD 3 89 2.13e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a caspase recruitment domain (CARD), an antiparallel six-helical bundle that mediates homotypic protein-protein interactions. The encoded protein is a microtubule-associated protein that has been shown to interact with receptor-interacting protein kinases and positively modulate signal transduction pathways converging on activation of the inducible transcription factor NF-kB. [provided by RefSeq, Jul 2008]
PHENOTYPE: Knockout mice are viable and grossly normal with no deficits in thymocytes, granulocytes, macrophages, NK cells or T- and B-cell subsets. Various signaling pathways mediating innate and adaptive immune responses appear unaltered. Mice are normally resistant to infection by a wide range of pathogens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 A G 8: 123,968,134 F273S Het
Abhd14b G T 9: 106,451,413 A78S probably benign Het
Adamtsl5 G A 10: 80,345,394 P51L probably benign Het
Adap1 A C 5: 139,273,425 F336V probably benign Het
Ankrd33b T C 15: 31,305,102 N172S probably damaging Het
Arhgap24 A G 5: 102,892,598 E560G possibly damaging Het
Ascc2 A T 11: 4,664,227 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
C130026I21Rik G A 1: 85,257,449 H130Y probably benign Het
Cby3 T G 11: 50,359,257 S2A probably damaging Het
Cct3 T C 3: 88,318,524 S385P possibly damaging Het
Cfap65 C T 1: 74,928,044 G249R probably benign Het
Cpne3 C A 4: 19,526,316 A408S probably damaging Het
Ctsr A C 13: 61,160,490 L280R probably damaging Het
D930048N14Rik GGG GGGG 11: 51,651,119 probably null Het
Dlg4 A G 11: 70,039,562 I388V probably benign Het
Ednrb T A 14: 103,843,197 I94F probably benign Het
Eftud2 C A 11: 102,846,236 A573S probably benign Het
Fsip2 C A 2: 82,981,566 P2743Q probably damaging Het
Gp2 C T 7: 119,442,787 C505Y probably benign Het
Ier5 C A 1: 155,098,560 D291Y probably benign Het
Ifi207 T C 1: 173,730,504 I223V unknown Het
Ifi208 T C 1: 173,683,278 V333A possibly damaging Het
Kank4 T C 4: 98,779,272 I313V probably benign Het
Klhl7 T C 5: 24,138,475 V263A possibly damaging Het
Klrg2 T C 6: 38,628,187 D314G probably benign Het
Lrr1 T C 12: 69,178,696 M382T possibly damaging Het
Ly6e A T 15: 74,958,341 Q48L probably benign Het
March6 C T 15: 31,505,746 W43* probably null Het
Mepe A G 5: 104,338,181 T396A possibly damaging Het
Myh8 T G 11: 67,283,614 L229R possibly damaging Het
Ndufa10 C G 1: 92,452,010 probably null Het
Nek1 C A 8: 61,034,032 A272E possibly damaging Het
Nr1h2 T C 7: 44,550,343 Y384C probably damaging Het
Olfr1223 C A 2: 89,144,379 V215F probably benign Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Phf2 A G 13: 48,821,602 F294S unknown Het
Polr3e A T 7: 120,931,305 I173F probably damaging Het
Ppfia2 A T 10: 106,836,091 R464* probably null Het
Ppp1r9a T A 6: 5,115,456 S860T probably benign Het
Rnf144a T C 12: 26,327,301 Y93C probably damaging Het
Ryr2 T C 13: 11,659,008 E3390G probably benign Het
Scn7a T C 2: 66,703,820 T504A possibly damaging Het
Slc26a5 T G 5: 21,813,906 D645A probably damaging Het
Ston2 T A 12: 91,648,297 I446F probably damaging Het
Tcp11l1 G A 2: 104,699,969 P57S probably damaging Het
Th G T 7: 142,893,064 H488Q probably benign Het
Tmprss4 A T 9: 45,184,363 I61N probably benign Het
Wdtc1 A G 4: 133,322,170 probably null Het
Xpnpep1 T C 19: 52,995,506 N596S probably benign Het
Other mutations in Card6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00755:Card6 APN 15 5098941 missense possibly damaging 0.93
IGL01307:Card6 APN 15 5100002 missense possibly damaging 0.93
IGL02016:Card6 APN 15 5108256 missense probably damaging 1.00
IGL02976:Card6 APN 15 5099828 nonsense probably null
IGL03328:Card6 APN 15 5105445 splice site probably benign
IGL03356:Card6 APN 15 5100241 missense probably benign 0.00
Mark UTSW 15 5098691 small deletion probably benign
sharps UTSW 15 5099896 nonsense probably null
PIT4131001:Card6 UTSW 15 5108306 missense probably damaging 1.00
PIT4142001:Card6 UTSW 15 5098631 missense unknown
PIT4458001:Card6 UTSW 15 5098691 small deletion probably benign
R0562:Card6 UTSW 15 5105166 missense probably damaging 1.00
R0943:Card6 UTSW 15 5100286 missense probably damaging 1.00
R1654:Card6 UTSW 15 5098732 missense probably benign 0.00
R3892:Card6 UTSW 15 5099296 missense probably benign 0.01
R4408:Card6 UTSW 15 5101054 missense probably damaging 0.97
R4856:Card6 UTSW 15 5105141 splice site probably null
R4886:Card6 UTSW 15 5105141 splice site probably null
R4998:Card6 UTSW 15 5100082 missense probably benign 0.00
R5050:Card6 UTSW 15 5100376 missense probably benign 0.00
R5365:Card6 UTSW 15 5105406 missense possibly damaging 0.53
R5518:Card6 UTSW 15 5105214 missense probably damaging 0.99
R5686:Card6 UTSW 15 5100953 missense probably damaging 0.99
R6088:Card6 UTSW 15 5105019 missense possibly damaging 0.56
R6194:Card6 UTSW 15 5098444 missense unknown
R6336:Card6 UTSW 15 5099164 nonsense probably null
R6539:Card6 UTSW 15 5105391 missense probably damaging 0.99
R6560:Card6 UTSW 15 5098885 missense probably damaging 1.00
R7132:Card6 UTSW 15 5098691 small deletion probably benign
R7157:Card6 UTSW 15 5100109 missense probably benign 0.07
R7174:Card6 UTSW 15 5098691 small deletion probably benign
R7186:Card6 UTSW 15 5098691 small deletion probably benign
R7338:Card6 UTSW 15 5099872 missense probably benign 0.09
R7430:Card6 UTSW 15 5099200 missense probably benign 0.00
R7579:Card6 UTSW 15 5098691 small deletion probably benign
R7677:Card6 UTSW 15 5098444 missense unknown
R7718:Card6 UTSW 15 5099787 missense possibly damaging 0.54
R7720:Card6 UTSW 15 5098423 missense unknown
R7756:Card6 UTSW 15 5099896 nonsense probably null
R7758:Card6 UTSW 15 5099896 nonsense probably null
R7762:Card6 UTSW 15 5105338 missense probably benign
R7786:Card6 UTSW 15 5098691 small deletion probably benign
R7808:Card6 UTSW 15 5099472 missense probably benign 0.00
R7817:Card6 UTSW 15 5098691 small deletion probably benign
R7822:Card6 UTSW 15 5098865 missense possibly damaging 0.82
R7902:Card6 UTSW 15 5098691 small deletion probably benign
R7977:Card6 UTSW 15 5100525 missense probably damaging 1.00
R7987:Card6 UTSW 15 5100525 missense probably damaging 1.00
R8295:Card6 UTSW 15 5098691 small deletion probably benign
R8303:Card6 UTSW 15 5105365 missense probably benign 0.13
R8691:Card6 UTSW 15 5099596 missense possibly damaging 0.76
RF013:Card6 UTSW 15 5100142 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- ACATTACTTCCTGGAGGGCAG -3'
(R):5'- GGCAAATTTCTGATGGCCTGG -3'

Sequencing Primer
(F):5'- AGCTTGAAGGGCCTCCATAG -3'
(R):5'- CAAATTTCTGATGGCCTGGTGGAAG -3'
Posted On2020-10-20