Incidental Mutation 'R8432:Ercc5'
ID 653778
Institutional Source Beutler Lab
Gene Symbol Ercc5
Ensembl Gene ENSMUSG00000026048
Gene Name excision repair cross-complementing rodent repair deficiency, complementation group 5
Synonyms Xpg
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8432 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 44147744-44181260 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 44167681 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 585 (K585*)
Ref Sequence ENSEMBL: ENSMUSP00000027214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027214]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000027214
AA Change: K585*
SMART Domains Protein: ENSMUSP00000027214
Gene: ENSMUSG00000026048
AA Change: K585*

DomainStartEndE-ValueType
XPGN 1 98 3.49e-50 SMART
low complexity region 104 115 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
low complexity region 305 326 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
low complexity region 641 650 N/A INTRINSIC
XPGI 776 845 1.02e-33 SMART
HhH2 847 880 2.94e-11 SMART
low complexity region 1130 1140 N/A INTRINSIC
low complexity region 1155 1169 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-strand specific DNA endonuclease that makes the 3' incision in DNA excision repair following UV-induced damage. The protein may also function in other cellular processes, including RNA polymerase II transcription, and transcription-coupled DNA repair. Mutations in this gene cause xeroderma pigmentosum complementation group G (XP-G), which is also referred to as xeroderma pigmentosum VII (XP7), a skin disorder characterized by hypersensitivity to UV light and increased susceptibility for skin cancer development following UV exposure. Some patients also develop Cockayne syndrome, which is characterized by severe growth defects, mental retardation, and cachexia. Read-through transcription exists between this gene and the neighboring upstream BIVM (basic, immunoglobulin-like variable motif containing) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mice display postnatal mortality, severely retarded postnatal growth, impaired small intestine development, reduced organ size, and hypersensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik C T 17: 28,899,571 R629H probably benign Het
Abhd5 A G 9: 122,368,252 Y168C probably damaging Het
Agbl1 A C 7: 77,124,686 R1119S unknown Het
Agpat5 A T 8: 18,846,761 N68Y probably benign Het
Ap4b1 G A 3: 103,820,819 R551Q probably benign Het
Arhgef28 T C 13: 97,951,583 I1122V probably benign Het
Arhgef40 T A 14: 51,989,400 D300E probably benign Het
Atxn7 T C 14: 14,013,635 V112A probably benign Het
AY358078 T A 14: 51,822,178 L324H unknown Het
Bhlhe40 TG TGG 6: 108,664,857 254 probably null Het
Cacng2 A G 15: 78,013,322 Y96H probably damaging Het
Cd2ap A T 17: 42,798,593 probably null Het
Cdh5 A T 8: 104,113,066 E56D probably damaging Het
Cfap65 C T 1: 74,928,044 G249R probably benign Het
Cpne3 A T 4: 19,535,227 S268R probably benign Het
Cubn T A 2: 13,381,799 I1552F probably benign Het
Dhrs7 G A 12: 72,664,807 probably benign Het
Dnah7a G C 1: 53,618,036 I860M possibly damaging Het
Dync1h1 A T 12: 110,618,142 M660L probably benign Het
Ecd T A 14: 20,320,930 T574S probably benign Het
Efna5 A G 17: 62,651,022 Y80H probably damaging Het
Erich4 A G 7: 25,615,108 S127P probably benign Het
Fam105a A T 15: 27,664,732 M46K possibly damaging Het
Gckr A T 5: 31,309,103 Q474L possibly damaging Het
Gid8 A G 2: 180,714,861 N97S probably benign Het
Gm28042 G T 2: 120,038,596 C557F probably damaging Het
Gp2 C T 7: 119,442,787 C505Y probably benign Het
Gzf1 A G 2: 148,690,195 T581A probably benign Het
Heatr5b A T 17: 78,803,501 Y973N probably damaging Het
Herc2 A G 7: 56,155,112 E2296G probably benign Het
Hydin A T 8: 110,597,951 N4648I probably benign Het
Mlip A T 9: 77,190,729 D157E possibly damaging Het
Mrpl19 A G 6: 81,962,155 V222A probably damaging Het
Myo18b A G 5: 112,764,512 V1896A probably benign Het
Myo9a G A 9: 59,780,265 V218M probably damaging Het
Nepn A T 10: 52,391,784 T49S probably benign Het
Nsd1 T G 13: 55,247,703 M1142R possibly damaging Het
Olfr671 T G 7: 104,975,992 T2P probably benign Het
Olfr889 A G 9: 38,115,976 Y65C probably damaging Het
Pcnt G A 10: 76,420,205 R734W probably damaging Het
Pgm2l1 A G 7: 100,260,053 D242G possibly damaging Het
Pkdrej T G 15: 85,817,293 I1481L probably benign Het
Prkag1 T C 15: 98,815,544 I87V possibly damaging Het
Psma1 A T 7: 114,273,845 I74N probably damaging Het
Rap1gds1 T C 3: 138,941,787 S547G probably damaging Het
Rbm19 T G 5: 120,175,926 F868V probably damaging Het
Riok1 T C 13: 38,037,492 V11A probably benign Het
Smpd3 T A 8: 106,257,677 probably null Het
Taar3 A T 10: 23,950,155 I200L probably benign Het
Taf12 A G 4: 132,291,917 Y139C probably damaging Het
Taf15 AGAAGTGGAGGCTACGGTGGAGACCGAAGTGG AGAAGTGG 11: 83,505,025 probably benign Het
Tc2n A T 12: 101,649,104 N487K probably benign Het
Tex15 A C 8: 33,576,544 I2001L probably damaging Het
Tmem168 A G 6: 13,602,536 F277S probably benign Het
Trim67 TGCCGCCGCCGCCGC TGCCGCCGCCGC 8: 124,794,062 probably benign Het
Tspan1 G T 4: 116,163,954 Q116K probably benign Het
Ttc24 G A 3: 88,070,059 R325C probably benign Het
Ttn C T 2: 76,863,556 E323K Het
Xirp2 A T 2: 67,510,618 M1068L probably benign Het
Zbtb38 A C 9: 96,686,238 M931R possibly damaging Het
Zfp931 A G 2: 178,069,553 *65Q probably null Het
Other mutations in Ercc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ercc5 APN 1 44163898 missense probably damaging 1.00
IGL00782:Ercc5 APN 1 44163935 missense probably damaging 1.00
IGL01418:Ercc5 APN 1 44167280 missense probably benign 0.43
IGL01710:Ercc5 APN 1 44164075 missense probably damaging 1.00
IGL02528:Ercc5 APN 1 44167802 missense probably benign 0.00
IGL02589:Ercc5 APN 1 44164049 missense probably damaging 1.00
IGL02651:Ercc5 APN 1 44156944 missense probably damaging 1.00
IGL02740:Ercc5 APN 1 44167492 missense probably benign 0.00
IGL02999:Ercc5 APN 1 44167654 missense probably benign 0.00
IGL03057:Ercc5 APN 1 44167001 missense probably damaging 0.99
IGL03246:Ercc5 APN 1 44167081 missense probably damaging 1.00
R0084:Ercc5 UTSW 1 44175976 missense possibly damaging 0.53
R0448:Ercc5 UTSW 1 44173940 missense probably damaging 1.00
R1120:Ercc5 UTSW 1 44161841 missense probably damaging 1.00
R1312:Ercc5 UTSW 1 44164019 missense probably damaging 1.00
R1411:Ercc5 UTSW 1 44178281 missense probably damaging 0.99
R1462:Ercc5 UTSW 1 44180624 missense probably damaging 0.98
R1462:Ercc5 UTSW 1 44180624 missense probably damaging 0.98
R1528:Ercc5 UTSW 1 44178241 nonsense probably null
R1637:Ercc5 UTSW 1 44167534 missense probably benign 0.00
R1668:Ercc5 UTSW 1 44167033 missense probably benign 0.04
R1714:Ercc5 UTSW 1 44167339 missense probably benign 0.01
R1780:Ercc5 UTSW 1 44167796 missense probably benign 0.17
R1800:Ercc5 UTSW 1 44173380 missense probably benign 0.00
R1835:Ercc5 UTSW 1 44180875 missense probably benign 0.00
R1836:Ercc5 UTSW 1 44180875 missense probably benign 0.00
R1886:Ercc5 UTSW 1 44175976 nonsense probably null
R2344:Ercc5 UTSW 1 44167169 missense probably benign
R2680:Ercc5 UTSW 1 44156973 missense probably benign 0.09
R3033:Ercc5 UTSW 1 44180574 missense possibly damaging 0.83
R3919:Ercc5 UTSW 1 44161931 missense probably damaging 1.00
R3933:Ercc5 UTSW 1 44167856 missense probably benign 0.17
R4444:Ercc5 UTSW 1 44158209 frame shift probably null
R4578:Ercc5 UTSW 1 44148148 missense probably benign 0.32
R4585:Ercc5 UTSW 1 44158857 missense probably benign 0.36
R4586:Ercc5 UTSW 1 44158857 missense probably benign 0.36
R4911:Ercc5 UTSW 1 44166871 missense possibly damaging 0.66
R4912:Ercc5 UTSW 1 44157057 missense probably damaging 1.00
R4942:Ercc5 UTSW 1 44175965 missense probably benign 0.09
R5155:Ercc5 UTSW 1 44180622 missense probably damaging 1.00
R5975:Ercc5 UTSW 1 44173406 missense probably benign 0.04
R5991:Ercc5 UTSW 1 44180830 nonsense probably null
R6161:Ercc5 UTSW 1 44167352 missense probably benign 0.00
R6250:Ercc5 UTSW 1 44164049 missense probably damaging 1.00
R7142:Ercc5 UTSW 1 44174214 missense probably damaging 1.00
R7183:Ercc5 UTSW 1 44161808 critical splice acceptor site probably null
R7183:Ercc5 UTSW 1 44161809 critical splice acceptor site probably null
R7235:Ercc5 UTSW 1 44178203 missense possibly damaging 0.68
R7349:Ercc5 UTSW 1 44180908 missense possibly damaging 0.56
R7369:Ercc5 UTSW 1 44180860 missense probably benign 0.39
R7486:Ercc5 UTSW 1 44148064 start codon destroyed probably null 1.00
R7586:Ercc5 UTSW 1 44175851 missense possibly damaging 0.49
R7904:Ercc5 UTSW 1 44175838 critical splice acceptor site probably null
R7994:Ercc5 UTSW 1 44178334 missense possibly damaging 0.94
R8795:Ercc5 UTSW 1 44163929 missense possibly damaging 0.92
R9144:Ercc5 UTSW 1 44174351 missense probably damaging 1.00
R9208:Ercc5 UTSW 1 44178343 missense possibly damaging 0.51
R9295:Ercc5 UTSW 1 44158857 missense probably damaging 1.00
X0011:Ercc5 UTSW 1 44180622 missense probably damaging 1.00
X0062:Ercc5 UTSW 1 44173974 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGAGTCCTCAGTGAAAGGG -3'
(R):5'- GGAATACCTACCATCAGACTCG -3'

Sequencing Primer
(F):5'- GGAACCCACCCTGGCAC -3'
(R):5'- GAATACCTACCATCAGACTCGCTTTC -3'
Posted On 2020-10-20