Incidental Mutation 'R0350:Gm11639'
Institutional Source Beutler Lab
Gene Symbol Gm11639
Ensembl Gene ENSMUSG00000040838
Gene Namepredicted gene 11639
MMRRC Submission 038557-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R0350 (G1)
Quality Score129
Status Not validated
Chromosomal Location104685707-105117394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104690880 bp
Amino Acid Change Valine to Alanine at position 16 (V16A)
Ref Sequence ENSEMBL: ENSMUSP00000148433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000148007] [ENSMUST00000212287]
Predicted Effect unknown
Transcript: ENSMUST00000148007
AA Change: V16A
SMART Domains Protein: ENSMUSP00000116040
Gene: ENSMUSG00000040838
AA Change: V16A

low complexity region 40 55 N/A INTRINSIC
low complexity region 116 129 N/A INTRINSIC
internal_repeat_4 146 233 3.42e-6 PROSPERO
internal_repeat_3 165 247 2.21e-6 PROSPERO
low complexity region 331 348 N/A INTRINSIC
internal_repeat_2 349 361 4.38e-8 PROSPERO
internal_repeat_2 371 383 4.38e-8 PROSPERO
low complexity region 385 640 N/A INTRINSIC
Pfam:EF-hand_8 677 729 8.7e-6 PFAM
low complexity region 835 842 N/A INTRINSIC
internal_repeat_1 879 1106 2.47e-14 PROSPERO
internal_repeat_4 1015 1108 3.42e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000212287
AA Change: V16A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T A 8: 9,987,600 Y66N probably damaging Het
Apol6 C T 15: 77,050,947 Q139* probably null Het
Armh1 C A 4: 117,215,556 E244* probably null Het
BC052040 T C 2: 115,776,930 Y255H possibly damaging Het
Ccdc130 C T 8: 84,260,648 E99K probably damaging Het
Cd1d1 A T 3: 86,997,573 H219Q probably benign Het
Cdca2 A G 14: 67,713,119 L121P probably benign Het
Cog4 T A 8: 110,853,696 L133I possibly damaging Het
Csf1 T C 3: 107,748,606 M370V probably benign Het
Ddi2 G A 4: 141,685,523 T26M probably benign Het
Dhcr7 A G 7: 143,837,770 D32G probably damaging Het
Exd1 T C 2: 119,523,566 N337S possibly damaging Het
Flii T C 11: 60,721,857 D227G probably damaging Het
Hsf1 A G 15: 76,500,479 T485A probably benign Het
Igfn1 G A 1: 135,956,767 R2614* probably null Het
Iqch T C 9: 63,500,876 T630A probably benign Het
Itgal T A 7: 127,322,081 D770E probably damaging Het
Mroh1 T A 15: 76,432,249 V759E probably damaging Het
Mrps17 A G 5: 129,718,145 probably benign Het
Mtpap A G 18: 4,396,195 S496G possibly damaging Het
Nkd1 T A 8: 88,585,216 Y39* probably null Het
Nmd3 A G 3: 69,743,574 Y359C probably damaging Het
Nr1h3 G A 2: 91,191,825 L153F possibly damaging Het
Nuf2 T A 1: 169,513,543 probably null Het
Olfr1218 T A 2: 89,055,356 K23N probably benign Het
Olfr1272 T C 2: 90,282,582 probably null Het
Olfr870 A T 9: 20,170,736 Y278* probably null Het
Pnn T C 12: 59,067,117 probably null Het
Ppm1j A G 3: 104,783,371 D230G probably benign Het
Ppp1r15a A T 7: 45,523,018 L650Q probably damaging Het
Prss37 T C 6: 40,514,959 E229G probably damaging Het
Rbm19 T C 5: 120,128,307 V465A possibly damaging Het
Rubcnl G T 14: 75,040,891 V372F probably damaging Het
Sema6a G T 18: 47,270,718 D595E probably benign Het
Slc35c1 A G 2: 92,459,032 F43S probably damaging Het
Slc39a5 C T 10: 128,396,750 probably null Het
Slco4c1 A G 1: 96,828,849 F583L probably benign Het
Sox9 A G 11: 112,784,876 Y297C probably damaging Het
Taf1b A G 12: 24,514,885 D167G possibly damaging Het
Trpm6 T C 19: 18,883,957 probably null Het
Uba6 A C 5: 86,144,378 V402G possibly damaging Het
Usp43 T C 11: 67,876,498 Y682C probably damaging Het
Vmn1r195 A G 13: 22,279,233 D291G probably damaging Het
Xpr1 A T 1: 155,330,468 F156Y probably damaging Het
Zfp318 T A 17: 46,413,198 H2042Q probably benign Het
Zfp937 T A 2: 150,239,302 D417E possibly damaging Het
Other mutations in Gm11639
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Gm11639 APN 11 105100021 missense probably damaging 1.00
IGL01308:Gm11639 APN 11 104720697 missense probably benign 0.03
IGL01483:Gm11639 APN 11 104739347 missense probably benign 0.03
IGL01695:Gm11639 APN 11 104736063 missense probably damaging 1.00
IGL01860:Gm11639 APN 11 104690921 missense probably benign 0.16
IGL01981:Gm11639 APN 11 104721432 intron probably benign
IGL01984:Gm11639 APN 11 104738308 missense probably benign 0.20
IGL02023:Gm11639 APN 11 104721432 intron probably benign
IGL02252:Gm11639 APN 11 104753927 missense possibly damaging 0.68
IGL02886:Gm11639 APN 11 105095874 missense possibly damaging 0.95
IGL03116:Gm11639 APN 11 104721533 missense probably benign 0.02
IGL03141:Gm11639 APN 11 105095870 missense probably damaging 0.99
IGL03242:Gm11639 APN 11 105106404 missense probably damaging 1.00
IGL03274:Gm11639 APN 11 104721093 missense probably benign 0.03
IGL03408:Gm11639 APN 11 104710621 missense probably benign 0.03
R0018:Gm11639 UTSW 11 104721552 critical splice donor site probably null
R0068:Gm11639 UTSW 11 104720822 missense probably benign 0.29
R0646:Gm11639 UTSW 11 104720501 missense probably benign 0.03
R0668:Gm11639 UTSW 11 104720492 missense probably benign 0.16
R0715:Gm11639 UTSW 11 104720880 missense possibly damaging 0.90
R0944:Gm11639 UTSW 11 104710730 splice site probably null
R1330:Gm11639 UTSW 11 104746290 missense possibly damaging 0.84
R1508:Gm11639 UTSW 11 104710677 missense probably benign 0.03
R1643:Gm11639 UTSW 11 104698978 missense probably benign 0.16
R1651:Gm11639 UTSW 11 104720666 missense probably benign 0.03
R1665:Gm11639 UTSW 11 104721114 missense probably benign 0.07
R1702:Gm11639 UTSW 11 104691006 missense probably benign 0.03
R1711:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1779:Gm11639 UTSW 11 104720939 missense probably benign 0.15
R1813:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1818:Gm11639 UTSW 11 104721507 missense probably benign 0.10
R1896:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1969:Gm11639 UTSW 11 104746264 missense probably damaging 1.00
R2139:Gm11639 UTSW 11 104751911 missense possibly damaging 0.53
R2165:Gm11639 UTSW 11 104751862 missense possibly damaging 0.93
R2359:Gm11639 UTSW 11 104739280 missense possibly damaging 0.80
R2394:Gm11639 UTSW 11 104738295 missense probably benign 0.17
R2406:Gm11639 UTSW 11 104720631 missense probably benign 0.03
R2570:Gm11639 UTSW 11 104733664 missense probably damaging 1.00
R3795:Gm11639 UTSW 11 104733675 missense possibly damaging 0.94
R4352:Gm11639 UTSW 11 104739314 missense probably null 0.25
R4359:Gm11639 UTSW 11 104733721 splice site probably null
R4424:Gm11639 UTSW 11 104736114 critical splice donor site probably null
R4895:Gm11639 UTSW 11 104720286 missense probably benign 0.16
R4895:Gm11639 UTSW 11 104749670 missense probably damaging 1.00
R5006:Gm11639 UTSW 11 104729677 splice site probably null
R5066:Gm11639 UTSW 11 104720664 missense probably benign 0.03
R5329:Gm11639 UTSW 11 104753806 splice site probably null
R5405:Gm11639 UTSW 11 104721192 missense probably benign 0.07
R5814:Gm11639 UTSW 11 104736114 critical splice donor site probably benign
R5888:Gm11639 UTSW 11 104721401 splice site probably benign
R5910:Gm11639 UTSW 11 104690934 missense probably benign 0.01
R5975:Gm11639 UTSW 11 104687549 start gained probably benign
R6019:Gm11639 UTSW 11 105042902 critical splice donor site probably null
R6028:Gm11639 UTSW 11 104769655 critical splice donor site probably null
R6048:Gm11639 UTSW 11 104944433 missense unknown
R6059:Gm11639 UTSW 11 105036769 missense probably benign 0.03
R6147:Gm11639 UTSW 11 104967740 missense unknown
R6176:Gm11639 UTSW 11 104792557 missense probably benign 0.16
R6181:Gm11639 UTSW 11 104831333 missense probably benign 0.25
R6196:Gm11639 UTSW 11 104855560 missense probably benign 0.07
R6245:Gm11639 UTSW 11 104785008 missense probably benign 0.03
R6262:Gm11639 UTSW 11 104893753 missense probably benign 0.24
R6263:Gm11639 UTSW 11 104919486 missense unknown
R6277:Gm11639 UTSW 11 105010322 missense possibly damaging 0.49
R6338:Gm11639 UTSW 11 104843208 nonsense probably null
R6355:Gm11639 UTSW 11 105005685 missense probably benign 0.29
R6356:Gm11639 UTSW 11 104893707 missense probably benign 0.19
R6365:Gm11639 UTSW 11 104924586 missense unknown
R6391:Gm11639 UTSW 11 104994317 missense possibly damaging 0.92
R6556:Gm11639 UTSW 11 105008251 missense probably null 0.03
R6604:Gm11639 UTSW 11 104698946 nonsense probably null
R6605:Gm11639 UTSW 11 104999281 splice site probably null
R6634:Gm11639 UTSW 11 104893783 missense probably benign 0.17
R6851:Gm11639 UTSW 11 105005695 missense probably benign 0.03
R6862:Gm11639 UTSW 11 104721458 nonsense probably null
R6949:Gm11639 UTSW 11 104909070 missense probably damaging 1.00
R6970:Gm11639 UTSW 11 104776356 missense probably benign 0.03
R7014:Gm11639 UTSW 11 104693422 missense probably benign 0.03
R7097:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7122:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7124:Gm11639 UTSW 11 104738274 missense probably benign 0.17
R7146:Gm11639 UTSW 11 104967752 missense unknown
R7146:Gm11639 UTSW 11 105022938 missense probably benign 0.03
R7154:Gm11639 UTSW 11 104699140 splice site probably null
R7175:Gm11639 UTSW 11 104947411 missense unknown
R7198:Gm11639 UTSW 11 104751885 missense probably benign 0.15
R7211:Gm11639 UTSW 11 104710713 missense probably benign 0.01
R7211:Gm11639 UTSW 11 104724609 critical splice donor site probably null
R7216:Gm11639 UTSW 11 104880549 missense possibly damaging 0.49
R7221:Gm11639 UTSW 11 104900606 missense probably benign 0.36
R7233:Gm11639 UTSW 11 104839843 missense possibly damaging 0.69
R7236:Gm11639 UTSW 11 104899267 missense probably benign 0.10
R7262:Gm11639 UTSW 11 104854606 critical splice donor site probably null
R7289:Gm11639 UTSW 11 105038358 missense probably benign 0.24
R7323:Gm11639 UTSW 11 105030011 missense probably benign 0.07
R7378:Gm11639 UTSW 11 104714702 missense probably benign 0.03
R7388:Gm11639 UTSW 11 104721045 missense probably damaging 0.97
R7390:Gm11639 UTSW 11 104724585 missense possibly damaging 0.46
R7411:Gm11639 UTSW 11 104999723 missense probably benign 0.10
R7468:Gm11639 UTSW 11 104749700 missense probably benign 0.17
R7497:Gm11639 UTSW 11 104762690 critical splice donor site probably null
R7620:Gm11639 UTSW 11 104832143 missense possibly damaging 0.95
R7638:Gm11639 UTSW 11 105036799 missense probably benign 0.03
R7661:Gm11639 UTSW 11 104726677 missense probably benign 0.03
R7667:Gm11639 UTSW 11 104751911 missense possibly damaging 0.53
R7682:Gm11639 UTSW 11 104964348 splice site probably null
R7708:Gm11639 UTSW 11 104964571 missense unknown
R7721:Gm11639 UTSW 11 104724540 nonsense probably null
R7747:Gm11639 UTSW 11 104842603 missense probably damaging 0.96
R7840:Gm11639 UTSW 11 104733713 missense probably benign 0.07
R7846:Gm11639 UTSW 11 104714745 critical splice donor site probably null
R7893:Gm11639 UTSW 11 104979360 missense unknown
R7897:Gm11639 UTSW 11 104998235 missense probably benign 0.24
R7936:Gm11639 UTSW 11 104999698 missense possibly damaging 0.89
R7936:Gm11639 UTSW 11 105046559 critical splice donor site probably null
R7959:Gm11639 UTSW 11 105042801 missense probably damaging 0.96
R8031:Gm11639 UTSW 11 104881469 missense possibly damaging 0.49
R8041:Gm11639 UTSW 11 104919479 missense unknown
R8054:Gm11639 UTSW 11 104730400 missense probably benign 0.07
R8056:Gm11639 UTSW 11 104909070 missense probably damaging 0.98
R8088:Gm11639 UTSW 11 104998246 missense probably benign 0.10
R8112:Gm11639 UTSW 11 104950200 missense unknown
R8340:Gm11639 UTSW 11 104986030 missense unknown
R8405:Gm11639 UTSW 11 104721198 missense probably benign 0.02
R8413:Gm11639 UTSW 11 104920309 missense unknown
X0026:Gm11639 UTSW 11 104720975 missense probably benign 0.07
Z1088:Gm11639 UTSW 11 104751902 missense probably damaging 0.96
Z1176:Gm11639 UTSW 11 105001967 missense probably benign 0.29
Z1177:Gm11639 UTSW 11 104739338 nonsense probably null
Z1177:Gm11639 UTSW 11 104820518 missense probably benign 0.03
Z1177:Gm11639 UTSW 11 104924019 missense unknown
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tgcaaatacttttctcctagtgtc -3'
Posted On2013-08-08