Incidental Mutation 'R8432:Cfap65'
ID653780
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Namecilia and flagella associated protein 65
SynonymsCcdc108, B230363K08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R8432 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location74902071-74935599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74928044 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 249 (G249R)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
Predicted Effect probably benign
Transcript: ENSMUST00000094844
AA Change: G249R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: G249R

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik C T 17: 28,899,571 R629H probably benign Het
Abhd5 A G 9: 122,368,252 Y168C probably damaging Het
Agbl1 A C 7: 77,124,686 R1119S unknown Het
Agpat5 A T 8: 18,846,761 N68Y probably benign Het
Ap4b1 G A 3: 103,820,819 R551Q probably benign Het
Arhgef28 T C 13: 97,951,583 I1122V probably benign Het
Arhgef40 T A 14: 51,989,400 D300E probably benign Het
Atxn7 T C 14: 14,013,635 V112A probably benign Het
AY358078 T A 14: 51,822,178 L324H unknown Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cacng2 A G 15: 78,013,322 Y96H probably damaging Het
Cd2ap A T 17: 42,798,593 probably null Het
Cdh5 A T 8: 104,113,066 E56D probably damaging Het
Cpne3 A T 4: 19,535,227 S268R probably benign Het
Cubn T A 2: 13,381,799 I1552F probably benign Het
Dhrs7 G A 12: 72,664,807 probably benign Het
Dnah7a G C 1: 53,618,036 I860M possibly damaging Het
Dync1h1 A T 12: 110,618,142 M660L probably benign Het
Ecd T A 14: 20,320,930 T574S probably benign Het
Efna5 A G 17: 62,651,022 Y80H probably damaging Het
Ercc5 A T 1: 44,167,681 K585* probably null Het
Erich4 A G 7: 25,615,108 S127P probably benign Het
Fam105a A T 15: 27,664,732 M46K possibly damaging Het
Gckr A T 5: 31,309,103 Q474L possibly damaging Het
Gid8 A G 2: 180,714,861 N97S probably benign Het
Gm28042 G T 2: 120,038,596 C557F probably damaging Het
Gp2 C T 7: 119,442,787 C505Y probably benign Het
Gzf1 A G 2: 148,690,195 T581A probably benign Het
Heatr5b A T 17: 78,803,501 Y973N probably damaging Het
Herc2 A G 7: 56,155,112 E2296G probably benign Het
Hydin A T 8: 110,597,951 N4648I probably benign Het
Mlip A T 9: 77,190,729 D157E possibly damaging Het
Mrpl19 A G 6: 81,962,155 V222A probably damaging Het
Myo18b A G 5: 112,764,512 V1896A probably benign Het
Myo9a G A 9: 59,780,265 V218M probably damaging Het
Nepn A T 10: 52,391,784 T49S probably benign Het
Nsd1 T G 13: 55,247,703 M1142R possibly damaging Het
Olfr671 T G 7: 104,975,992 T2P probably benign Het
Olfr889 A G 9: 38,115,976 Y65C probably damaging Het
Pcnt G A 10: 76,420,205 R734W probably damaging Het
Pgm2l1 A G 7: 100,260,053 D242G possibly damaging Het
Pkdrej T G 15: 85,817,293 I1481L probably benign Het
Prkag1 T C 15: 98,815,544 I87V possibly damaging Het
Psma1 A T 7: 114,273,845 I74N probably damaging Het
Rap1gds1 T C 3: 138,941,787 S547G probably damaging Het
Rbm19 T G 5: 120,175,926 F868V probably damaging Het
Riok1 T C 13: 38,037,492 V11A probably benign Het
Smpd3 T A 8: 106,257,677 probably null Het
Taar3 A T 10: 23,950,155 I200L probably benign Het
Taf12 A G 4: 132,291,917 Y139C probably damaging Het
Taf15 AGAAGTGGAGGCTACGGTGGAGACCGAAGTGG AGAAGTGG 11: 83,505,025 probably benign Het
Tc2n A T 12: 101,649,104 N487K probably benign Het
Tex15 A C 8: 33,576,544 I2001L probably damaging Het
Tmem168 A G 6: 13,602,536 F277S probably benign Het
Trim67 TGCCGCCGCCGCCGC TGCCGCCGCCGC 8: 124,794,062 probably benign Het
Tspan1 G T 4: 116,163,954 Q116K probably benign Het
Ttc24 G A 3: 88,070,059 R325C probably benign Het
Ttn C T 2: 76,863,556 E323K Het
Xirp2 A T 2: 67,510,618 M1068L probably benign Het
Zbtb38 A C 9: 96,686,238 M931R possibly damaging Het
Zfp931 A G 2: 178,069,553 *65Q probably null Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74919183 critical splice donor site probably null
IGL01526:Cfap65 APN 1 74911078 missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74927194 missense probably benign
IGL01780:Cfap65 APN 1 74928348 nonsense probably null
IGL01993:Cfap65 APN 1 74920543 missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74928145 missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74928348 nonsense probably null
IGL02357:Cfap65 APN 1 74928348 nonsense probably null
IGL02576:Cfap65 APN 1 74903458 missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74905080 missense probably benign 0.00
IGL02792:Cfap65 APN 1 74927178 missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74911108 nonsense probably null
IGL03101:Cfap65 APN 1 74928433 missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74927619 missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74904642 missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74928342 missense probably benign 0.05
R0077:Cfap65 UTSW 1 74931918 missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74931958 nonsense probably null
R0281:Cfap65 UTSW 1 74927071 missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74904067 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929301 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929302 missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74926444 missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74920601 missense probably benign 0.00
R0361:Cfap65 UTSW 1 74925440 missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74916884 missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74918444 missense probably benign 0.01
R0646:Cfap65 UTSW 1 74902169 missense probably benign 0.09
R0734:Cfap65 UTSW 1 74918887 missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74904682 missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74921519 missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74902447 missense probably damaging 0.98
R1079:Cfap65 UTSW 1 74905713 missense probably damaging 0.99
R1083:Cfap65 UTSW 1 74918504 splice site probably benign
R1159:Cfap65 UTSW 1 74929340 missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74925104 missense probably benign 0.03
R1644:Cfap65 UTSW 1 74917175 missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74918948 missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74907660 missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74917199 missense probably benign 0.30
R2132:Cfap65 UTSW 1 74907691 missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74917273 frame shift probably null
R2219:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74926475 missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74927186 small insertion probably benign
R3114:Cfap65 UTSW 1 74927132 missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74920542 missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74927681 missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74903358 missense probably benign 0.17
R4547:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74904056 missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74925354 intron probably benign
R4701:Cfap65 UTSW 1 74918908 missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74928361 missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74927632 missense probably benign 0.06
R4831:Cfap65 UTSW 1 74917295 missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74925557 missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74919261 missense probably benign 0.00
R4881:Cfap65 UTSW 1 74907613 missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74903124 missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74906336 nonsense probably null
R5074:Cfap65 UTSW 1 74922978 missense probably benign 0.04
R5083:Cfap65 UTSW 1 74906441 missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74926516 missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74924902 missense probably benign 0.07
R5333:Cfap65 UTSW 1 74903175 missense probably benign 0.03
R5417:Cfap65 UTSW 1 74925100 missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74907518 intron probably benign
R5669:Cfap65 UTSW 1 74924968 missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74923031 missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74920405 missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74903139 missense probably benign 0.14
R6425:Cfap65 UTSW 1 74927709 missense probably benign 0.00
R6677:Cfap65 UTSW 1 74904685 missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74917286 missense probably benign 0.00
R6838:Cfap65 UTSW 1 74932021 missense probably benign 0.06
R6861:Cfap65 UTSW 1 74925115 missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74931899 missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74926633 missense probably benign 0.01
R7320:Cfap65 UTSW 1 74926604 missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74921583 missense probably benign 0.07
R7426:Cfap65 UTSW 1 74920426 missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74926610 missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74902434 missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74933144 missense probably benign 0.44
R7704:Cfap65 UTSW 1 74928368 missense probably benign 0.19
R7727:Cfap65 UTSW 1 74926625 missense probably benign 0.00
R7895:Cfap65 UTSW 1 74933162 missense probably benign 0.05
R8344:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8345:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8413:Cfap65 UTSW 1 74917169 nonsense probably null
R8431:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8528:Cfap65 UTSW 1 74905937 missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74903223 missense probably benign 0.43
RF009:Cfap65 UTSW 1 74905647 missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74910747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCGTGTATCGTGTGTCC -3'
(R):5'- ACTCCCTCACTCTTAGGGAC -3'

Sequencing Primer
(F):5'- TCTACCACTGGGAGGGATAGTC -3'
(R):5'- TCACTCTTAGGGACCTGCC -3'
Posted On2020-10-20