Incidental Mutation 'R8432:Trim67'
ID653812
Institutional Source Beutler Lab
Gene Symbol Trim67
Ensembl Gene ENSMUSG00000036913
Gene Nametripartite motif-containing 67
SynonymsD130049O21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R8432 (G1)
Quality Score106.467
Status Not validated
Chromosome8
Chromosomal Location124793092-124834713 bp(+) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) TGCCGCCGCCGCCGC to TGCCGCCGCCGC at 124794062 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041106] [ENSMUST00000167588] [ENSMUST00000211867]
Predicted Effect probably benign
Transcript: ENSMUST00000041106
SMART Domains Protein: ENSMUSP00000040601
Gene: ENSMUSG00000036913

DomainStartEndE-ValueType
RING 7 157 1.41e-4 SMART
BBOX 198 248 4.65e-5 SMART
BBOX 285 327 3.04e-9 SMART
BBC 334 460 1.18e-28 SMART
FN3 498 579 1.75e-6 SMART
Pfam:SPRY 635 755 1.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167588
SMART Domains Protein: ENSMUSP00000130343
Gene: ENSMUSG00000036913

DomainStartEndE-ValueType
RING 7 157 1.41e-4 SMART
BBOX 198 248 4.65e-5 SMART
BBOX 285 327 3.04e-9 SMART
BBC 334 460 1.18e-28 SMART
FN3 498 579 1.75e-6 SMART
Pfam:SPRY 633 756 3.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211867
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik C T 17: 28,899,571 R629H probably benign Het
Abhd5 A G 9: 122,368,252 Y168C probably damaging Het
Agbl1 A C 7: 77,124,686 R1119S unknown Het
Agpat5 A T 8: 18,846,761 N68Y probably benign Het
Ap4b1 G A 3: 103,820,819 R551Q probably benign Het
Arhgef28 T C 13: 97,951,583 I1122V probably benign Het
Arhgef40 T A 14: 51,989,400 D300E probably benign Het
Atxn7 T C 14: 14,013,635 V112A probably benign Het
AY358078 T A 14: 51,822,178 L324H unknown Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cacng2 A G 15: 78,013,322 Y96H probably damaging Het
Cd2ap A T 17: 42,798,593 probably null Het
Cdh5 A T 8: 104,113,066 E56D probably damaging Het
Cfap65 C T 1: 74,928,044 G249R probably benign Het
Cpne3 A T 4: 19,535,227 S268R probably benign Het
Cubn T A 2: 13,381,799 I1552F probably benign Het
Dhrs7 G A 12: 72,664,807 probably benign Het
Dnah7a G C 1: 53,618,036 I860M possibly damaging Het
Dync1h1 A T 12: 110,618,142 M660L probably benign Het
Ecd T A 14: 20,320,930 T574S probably benign Het
Efna5 A G 17: 62,651,022 Y80H probably damaging Het
Ercc5 A T 1: 44,167,681 K585* probably null Het
Erich4 A G 7: 25,615,108 S127P probably benign Het
Fam105a A T 15: 27,664,732 M46K possibly damaging Het
Gckr A T 5: 31,309,103 Q474L possibly damaging Het
Gid8 A G 2: 180,714,861 N97S probably benign Het
Gm28042 G T 2: 120,038,596 C557F probably damaging Het
Gp2 C T 7: 119,442,787 C505Y probably benign Het
Gzf1 A G 2: 148,690,195 T581A probably benign Het
Heatr5b A T 17: 78,803,501 Y973N probably damaging Het
Herc2 A G 7: 56,155,112 E2296G probably benign Het
Hydin A T 8: 110,597,951 N4648I probably benign Het
Mlip A T 9: 77,190,729 D157E possibly damaging Het
Mrpl19 A G 6: 81,962,155 V222A probably damaging Het
Myo18b A G 5: 112,764,512 V1896A probably benign Het
Myo9a G A 9: 59,780,265 V218M probably damaging Het
Nepn A T 10: 52,391,784 T49S probably benign Het
Nsd1 T G 13: 55,247,703 M1142R possibly damaging Het
Olfr671 T G 7: 104,975,992 T2P probably benign Het
Olfr889 A G 9: 38,115,976 Y65C probably damaging Het
Pcnt G A 10: 76,420,205 R734W probably damaging Het
Pgm2l1 A G 7: 100,260,053 D242G possibly damaging Het
Pkdrej T G 15: 85,817,293 I1481L probably benign Het
Prkag1 T C 15: 98,815,544 I87V possibly damaging Het
Psma1 A T 7: 114,273,845 I74N probably damaging Het
Rap1gds1 T C 3: 138,941,787 S547G probably damaging Het
Rbm19 T G 5: 120,175,926 F868V probably damaging Het
Riok1 T C 13: 38,037,492 V11A probably benign Het
Smpd3 T A 8: 106,257,677 probably null Het
Taar3 A T 10: 23,950,155 I200L probably benign Het
Taf12 A G 4: 132,291,917 Y139C probably damaging Het
Taf15 AGAAGTGGAGGCTACGGTGGAGACCGAAGTGG AGAAGTGG 11: 83,505,025 probably benign Het
Tc2n A T 12: 101,649,104 N487K probably benign Het
Tex15 A C 8: 33,576,544 I2001L probably damaging Het
Tmem168 A G 6: 13,602,536 F277S probably benign Het
Tspan1 G T 4: 116,163,954 Q116K probably benign Het
Ttc24 G A 3: 88,070,059 R325C probably benign Het
Ttn C T 2: 76,863,556 E323K Het
Xirp2 A T 2: 67,510,618 M1068L probably benign Het
Zbtb38 A C 9: 96,686,238 M931R possibly damaging Het
Zfp931 A G 2: 178,069,553 *65Q probably null Het
Other mutations in Trim67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Trim67 APN 8 124815060 splice site probably benign
IGL01676:Trim67 APN 8 124815160 missense possibly damaging 0.51
IGL01779:Trim67 APN 8 124828121 missense probably damaging 1.00
IGL02057:Trim67 APN 8 124823130 missense probably benign 0.00
IGL02201:Trim67 APN 8 124794058 missense probably benign 0.26
IGL02304:Trim67 APN 8 124825952 missense probably damaging 1.00
R0068:Trim67 UTSW 8 124794568 missense probably damaging 0.97
R0241:Trim67 UTSW 8 124823190 missense probably damaging 0.99
R0319:Trim67 UTSW 8 124823227 missense probably damaging 0.98
R0471:Trim67 UTSW 8 124794658 missense probably benign 0.01
R1171:Trim67 UTSW 8 124829081 missense probably damaging 0.97
R1175:Trim67 UTSW 8 124817035 missense probably damaging 0.99
R1444:Trim67 UTSW 8 124823193 missense probably benign 0.01
R1596:Trim67 UTSW 8 124826139 missense probably damaging 0.97
R1706:Trim67 UTSW 8 124794421 missense probably damaging 1.00
R4951:Trim67 UTSW 8 124794667 missense probably benign
R5200:Trim67 UTSW 8 124824850 missense probably damaging 0.99
R5787:Trim67 UTSW 8 124794312 nonsense probably null
R6023:Trim67 UTSW 8 124815104 missense probably damaging 0.99
R6290:Trim67 UTSW 8 124823179 missense probably benign 0.00
R6536:Trim67 UTSW 8 124794342 missense possibly damaging 0.51
R7315:Trim67 UTSW 8 124794330 missense probably benign 0.18
R7660:Trim67 UTSW 8 124820285 missense probably damaging 1.00
R8446:Trim67 UTSW 8 124793991 missense probably damaging 0.99
R8713:Trim67 UTSW 8 124820335 missense probably null 0.06
R8897:Trim67 UTSW 8 124825979 missense probably benign
Z1088:Trim67 UTSW 8 124817041 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCTTCGGAGCCTTGACCATTC -3'
(R):5'- TGCACAATGCCCTCCAGTAG -3'

Sequencing Primer
(F):5'- CATTCTTGGCTGGTCCCGAG -3'
(R):5'- ACTCCATTGGGGGACTTGAG -3'
Posted On2020-10-20