Incidental Mutation 'R8432:Myo9a'
ID653814
Institutional Source Beutler Lab
Gene Symbol Myo9a
Ensembl Gene ENSMUSG00000039585
Gene Namemyosin IXa
SynonymsC130068I12Rik, 4732465J09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8432 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location59750896-59928866 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59780265 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 218 (V218M)
Ref Sequence ENSEMBL: ENSMUSP00000122852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000128341] [ENSMUST00000135298] [ENSMUST00000136740]
Predicted Effect probably damaging
Transcript: ENSMUST00000128341
AA Change: V218M

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119401
Gene: ENSMUSG00000039585
AA Change: V218M

DomainStartEndE-ValueType
RA 14 112 5.57e-30 SMART
low complexity region 129 137 N/A INTRINSIC
MYSc 140 1018 N/A SMART
IQ 1019 1041 1.79e1 SMART
IQ 1042 1064 4.11e0 SMART
IQ 1074 1096 1.9e-2 SMART
IQ 1115 1137 1.01e-6 SMART
IQ 1138 1160 8.71e-2 SMART
low complexity region 1161 1173 N/A INTRINSIC
coiled coil region 1265 1285 N/A INTRINSIC
low complexity region 1372 1384 N/A INTRINSIC
coiled coil region 1492 1539 N/A INTRINSIC
Blast:MYSc 1685 1938 6e-89 BLAST
low complexity region 1982 1993 N/A INTRINSIC
C1 2002 2050 2.6e-9 SMART
RhoGAP 2075 2250 3.36e-73 SMART
coiled coil region 2320 2360 N/A INTRINSIC
low complexity region 2419 2438 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000135298
AA Change: V218M

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117432
Gene: ENSMUSG00000039585
AA Change: V218M

DomainStartEndE-ValueType
RA 14 112 5.57e-30 SMART
low complexity region 129 137 N/A INTRINSIC
MYSc 140 1018 N/A SMART
IQ 1019 1041 1.79e1 SMART
IQ 1042 1064 4.11e0 SMART
IQ 1074 1096 1.9e-2 SMART
IQ 1115 1137 1.01e-6 SMART
IQ 1138 1160 8.71e-2 SMART
low complexity region 1161 1173 N/A INTRINSIC
coiled coil region 1265 1285 N/A INTRINSIC
low complexity region 1372 1384 N/A INTRINSIC
coiled coil region 1492 1539 N/A INTRINSIC
low complexity region 1744 1759 N/A INTRINSIC
low complexity region 2053 2064 N/A INTRINSIC
C1 2073 2121 2.6e-9 SMART
RhoGAP 2146 2321 3.36e-73 SMART
coiled coil region 2391 2431 N/A INTRINSIC
low complexity region 2490 2509 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136740
AA Change: V218M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122852
Gene: ENSMUSG00000039585
AA Change: V218M

DomainStartEndE-ValueType
RA 14 112 5.57e-30 SMART
low complexity region 129 137 N/A INTRINSIC
MYSc 140 1018 N/A SMART
IQ 1019 1041 1.79e1 SMART
IQ 1042 1064 4.11e0 SMART
IQ 1074 1096 1.9e-2 SMART
IQ 1115 1137 1.01e-6 SMART
IQ 1138 1160 8.71e-2 SMART
low complexity region 1161 1173 N/A INTRINSIC
coiled coil region 1265 1285 N/A INTRINSIC
low complexity region 1372 1384 N/A INTRINSIC
coiled coil region 1492 1539 N/A INTRINSIC
low complexity region 1744 1759 N/A INTRINSIC
low complexity region 2053 2064 N/A INTRINSIC
C1 2073 2121 2.6e-9 SMART
RhoGAP 2146 2321 3.36e-73 SMART
coiled coil region 2409 2449 N/A INTRINSIC
low complexity region 2508 2527 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. They function as actin-based molecular motors. Mutations in this gene have been associated with Bardet-Biedl Syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous KO leads to obstructive hydrocephaly caused by blockage of the third ventricle and the rostral aqueduct caused by developmental failures of their ependymal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik C T 17: 28,899,571 R629H probably benign Het
Abhd5 A G 9: 122,368,252 Y168C probably damaging Het
Agbl1 A C 7: 77,124,686 R1119S unknown Het
Agpat5 A T 8: 18,846,761 N68Y probably benign Het
Ap4b1 G A 3: 103,820,819 R551Q probably benign Het
Arhgef28 T C 13: 97,951,583 I1122V probably benign Het
Arhgef40 T A 14: 51,989,400 D300E probably benign Het
Atxn7 T C 14: 14,013,635 V112A probably benign Het
AY358078 T A 14: 51,822,178 L324H unknown Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cacng2 A G 15: 78,013,322 Y96H probably damaging Het
Cd2ap A T 17: 42,798,593 probably null Het
Cdh5 A T 8: 104,113,066 E56D probably damaging Het
Cfap65 C T 1: 74,928,044 G249R probably benign Het
Cpne3 A T 4: 19,535,227 S268R probably benign Het
Cubn T A 2: 13,381,799 I1552F probably benign Het
Dhrs7 G A 12: 72,664,807 probably benign Het
Dnah7a G C 1: 53,618,036 I860M possibly damaging Het
Dync1h1 A T 12: 110,618,142 M660L probably benign Het
Ecd T A 14: 20,320,930 T574S probably benign Het
Efna5 A G 17: 62,651,022 Y80H probably damaging Het
Ercc5 A T 1: 44,167,681 K585* probably null Het
Erich4 A G 7: 25,615,108 S127P probably benign Het
Fam105a A T 15: 27,664,732 M46K possibly damaging Het
Gckr A T 5: 31,309,103 Q474L possibly damaging Het
Gid8 A G 2: 180,714,861 N97S probably benign Het
Gm28042 G T 2: 120,038,596 C557F probably damaging Het
Gp2 C T 7: 119,442,787 C505Y probably benign Het
Gzf1 A G 2: 148,690,195 T581A probably benign Het
Heatr5b A T 17: 78,803,501 Y973N probably damaging Het
Herc2 A G 7: 56,155,112 E2296G probably benign Het
Hydin A T 8: 110,597,951 N4648I probably benign Het
Mlip A T 9: 77,190,729 D157E possibly damaging Het
Mrpl19 A G 6: 81,962,155 V222A probably damaging Het
Myo18b A G 5: 112,764,512 V1896A probably benign Het
Nepn A T 10: 52,391,784 T49S probably benign Het
Nsd1 T G 13: 55,247,703 M1142R possibly damaging Het
Olfr671 T G 7: 104,975,992 T2P probably benign Het
Olfr889 A G 9: 38,115,976 Y65C probably damaging Het
Pcnt G A 10: 76,420,205 R734W probably damaging Het
Pgm2l1 A G 7: 100,260,053 D242G possibly damaging Het
Pkdrej T G 15: 85,817,293 I1481L probably benign Het
Prkag1 T C 15: 98,815,544 I87V possibly damaging Het
Psma1 A T 7: 114,273,845 I74N probably damaging Het
Rap1gds1 T C 3: 138,941,787 S547G probably damaging Het
Rbm19 T G 5: 120,175,926 F868V probably damaging Het
Riok1 T C 13: 38,037,492 V11A probably benign Het
Smpd3 T A 8: 106,257,677 probably null Het
Taar3 A T 10: 23,950,155 I200L probably benign Het
Taf12 A G 4: 132,291,917 Y139C probably damaging Het
Taf15 AGAAGTGGAGGCTACGGTGGAGACCGAAGTGG AGAAGTGG 11: 83,505,025 probably benign Het
Tc2n A T 12: 101,649,104 N487K probably benign Het
Tex15 A C 8: 33,576,544 I2001L probably damaging Het
Tmem168 A G 6: 13,602,536 F277S probably benign Het
Trim67 TGCCGCCGCCGCCGC TGCCGCCGCCGC 8: 124,794,062 probably benign Het
Tspan1 G T 4: 116,163,954 Q116K probably benign Het
Ttc24 G A 3: 88,070,059 R325C probably benign Het
Ttn C T 2: 76,863,556 E323K Het
Xirp2 A T 2: 67,510,618 M1068L probably benign Het
Zbtb38 A C 9: 96,686,238 M931R possibly damaging Het
Zfp931 A G 2: 178,069,553 *65Q probably null Het
Other mutations in Myo9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Myo9a APN 9 59843059 splice site probably benign
IGL00510:Myo9a APN 9 59832181 splice site probably benign
IGL00710:Myo9a APN 9 59875311 missense probably damaging 1.00
IGL00963:Myo9a APN 9 59900372 missense probably damaging 0.98
IGL01087:Myo9a APN 9 59790078 missense possibly damaging 0.93
IGL01145:Myo9a APN 9 59855375 missense probably benign 0.18
IGL01403:Myo9a APN 9 59871563 missense probably damaging 0.98
IGL01528:Myo9a APN 9 59779674 missense probably damaging 1.00
IGL01608:Myo9a APN 9 59870836 nonsense probably null
IGL01701:Myo9a APN 9 59884594 critical splice donor site probably null
IGL01918:Myo9a APN 9 59779702 missense probably damaging 1.00
IGL02026:Myo9a APN 9 59905962 missense probably damaging 0.99
IGL02139:Myo9a APN 9 59779992 missense probably benign 0.07
IGL02176:Myo9a APN 9 59870553 missense probably benign 0.45
IGL02272:Myo9a APN 9 59884600 splice site probably benign
IGL02283:Myo9a APN 9 59871673 missense probably benign 0.00
IGL02499:Myo9a APN 9 59815386 splice site probably benign
IGL02652:Myo9a APN 9 59863928 missense probably damaging 1.00
IGL02666:Myo9a APN 9 59924904 missense probably benign 0.02
IGL02878:Myo9a APN 9 59908300 critical splice donor site probably null
IGL02982:Myo9a APN 9 59908208 nonsense probably null
IGL03072:Myo9a APN 9 59809442 missense possibly damaging 0.83
IGL03090:Myo9a APN 9 59894135 splice site probably benign
IGL03111:Myo9a APN 9 59827243 missense probably benign 0.19
IGL03389:Myo9a APN 9 59869607 missense probably damaging 1.00
essentials UTSW 9 59894866 missense probably benign 0.09
necessities UTSW 9 59815334 missense probably damaging 1.00
PIT4402001:Myo9a UTSW 9 59870436 missense possibly damaging 0.83
R0013:Myo9a UTSW 9 59860206 splice site probably benign
R0013:Myo9a UTSW 9 59860206 splice site probably benign
R0018:Myo9a UTSW 9 59871724 missense probably benign 0.00
R0018:Myo9a UTSW 9 59871724 missense probably benign 0.00
R0329:Myo9a UTSW 9 59923677 missense probably damaging 1.00
R0423:Myo9a UTSW 9 59895336 missense probably damaging 1.00
R0521:Myo9a UTSW 9 59894352 missense probably damaging 1.00
R0607:Myo9a UTSW 9 59921793 missense probably benign 0.02
R0652:Myo9a UTSW 9 59871926 missense probably benign
R0653:Myo9a UTSW 9 59924991 missense probably damaging 1.00
R0723:Myo9a UTSW 9 59871100 missense probably benign 0.01
R0784:Myo9a UTSW 9 59896545 splice site probably benign
R0842:Myo9a UTSW 9 59871067 missense probably benign 0.02
R1055:Myo9a UTSW 9 59855370 missense probably benign 0.01
R1056:Myo9a UTSW 9 59832201 missense possibly damaging 0.64
R1195:Myo9a UTSW 9 59895200 missense probably damaging 1.00
R1195:Myo9a UTSW 9 59895200 missense probably damaging 1.00
R1195:Myo9a UTSW 9 59895200 missense probably damaging 1.00
R1615:Myo9a UTSW 9 59788456 missense possibly damaging 0.68
R1698:Myo9a UTSW 9 59868181 missense probably benign 0.05
R1715:Myo9a UTSW 9 59832300 missense probably damaging 0.99
R1981:Myo9a UTSW 9 59894146 missense probably benign
R2228:Myo9a UTSW 9 59894180 missense probably benign 0.06
R2272:Myo9a UTSW 9 59815301 missense probably damaging 1.00
R2327:Myo9a UTSW 9 59779765 missense probably benign 0.11
R2990:Myo9a UTSW 9 59924889 missense possibly damaging 0.95
R3161:Myo9a UTSW 9 59832315 splice site probably benign
R3721:Myo9a UTSW 9 59868180 missense probably benign
R3928:Myo9a UTSW 9 59895283 missense probably damaging 1.00
R4197:Myo9a UTSW 9 59894866 missense probably benign 0.09
R4212:Myo9a UTSW 9 59906066 nonsense probably null
R4610:Myo9a UTSW 9 59871882 missense probably benign
R4616:Myo9a UTSW 9 59821649 missense probably damaging 1.00
R4621:Myo9a UTSW 9 59871072 missense probably benign 0.00
R4623:Myo9a UTSW 9 59871072 missense probably benign 0.00
R4632:Myo9a UTSW 9 59869664 missense probably benign 0.00
R4657:Myo9a UTSW 9 59875416 critical splice donor site probably null
R4892:Myo9a UTSW 9 59824242 missense probably damaging 0.98
R4897:Myo9a UTSW 9 59896517 missense probably benign 0.07
R4966:Myo9a UTSW 9 59871734 missense probably benign 0.00
R4993:Myo9a UTSW 9 59861472 nonsense probably null
R5160:Myo9a UTSW 9 59871802 missense probably benign 0.24
R5233:Myo9a UTSW 9 59910617 missense probably damaging 1.00
R5271:Myo9a UTSW 9 59907382 missense probably damaging 1.00
R5308:Myo9a UTSW 9 59863961 missense probably damaging 1.00
R5367:Myo9a UTSW 9 59900449 missense probably damaging 0.96
R5432:Myo9a UTSW 9 59865670 missense possibly damaging 0.94
R5459:Myo9a UTSW 9 59884520 missense probably damaging 0.98
R5511:Myo9a UTSW 9 59780212 missense probably damaging 1.00
R5568:Myo9a UTSW 9 59874628 missense probably benign
R5573:Myo9a UTSW 9 59871001 missense probably benign
R5589:Myo9a UTSW 9 59895244 nonsense probably null
R5607:Myo9a UTSW 9 59863944 missense probably damaging 1.00
R5633:Myo9a UTSW 9 59868184 missense possibly damaging 0.60
R5885:Myo9a UTSW 9 59871220 missense probably benign
R6024:Myo9a UTSW 9 59855388 missense possibly damaging 0.68
R6086:Myo9a UTSW 9 59790057 nonsense probably null
R6146:Myo9a UTSW 9 59871229 missense probably benign 0.01
R6194:Myo9a UTSW 9 59869750 missense probably benign 0.00
R6213:Myo9a UTSW 9 59827258 missense probably damaging 1.00
R6368:Myo9a UTSW 9 59924948 missense probably benign 0.01
R6550:Myo9a UTSW 9 59868199 missense probably damaging 1.00
R6612:Myo9a UTSW 9 59827196 missense probably damaging 1.00
R6665:Myo9a UTSW 9 59871872 missense probably benign 0.09
R6951:Myo9a UTSW 9 59894768 missense probably damaging 1.00
R7026:Myo9a UTSW 9 59815334 missense probably damaging 1.00
R7107:Myo9a UTSW 9 59870815 missense probably benign 0.44
R7310:Myo9a UTSW 9 59871153 missense probably benign 0.08
R7473:Myo9a UTSW 9 59895244 missense probably benign 0.31
R7723:Myo9a UTSW 9 59779858 missense probably damaging 1.00
R7823:Myo9a UTSW 9 59811950 missense probably damaging 1.00
R7824:Myo9a UTSW 9 59860109 missense probably damaging 1.00
R7965:Myo9a UTSW 9 59788438 missense probably damaging 1.00
R8031:Myo9a UTSW 9 59780091 missense probably benign 0.33
R8055:Myo9a UTSW 9 59907460 missense probably damaging 1.00
R8071:Myo9a UTSW 9 59874648 missense probably benign
R8250:Myo9a UTSW 9 59860109 missense probably damaging 1.00
R8260:Myo9a UTSW 9 59910678 missense probably benign 0.08
R8355:Myo9a UTSW 9 59909847 missense probably damaging 1.00
R8470:Myo9a UTSW 9 59832290 missense probably damaging 1.00
R8528:Myo9a UTSW 9 59860140 missense probably damaging 1.00
R8681:Myo9a UTSW 9 59868111 missense probably benign 0.16
R8690:Myo9a UTSW 9 59875374 missense probably benign
R8793:Myo9a UTSW 9 59884567 missense probably benign 0.03
R8812:Myo9a UTSW 9 59779747 missense probably benign 0.14
RF018:Myo9a UTSW 9 59869586 missense probably benign 0.00
RF019:Myo9a UTSW 9 59921772 missense probably benign 0.00
Z1176:Myo9a UTSW 9 59895259 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCCTCAACAGAAAGACTTTG -3'
(R):5'- AAGTACTGGTCCAGCTCCAAG -3'

Sequencing Primer
(F):5'- GCTTGCCTGATTTGAATGAGAAAAC -3'
(R):5'- GGTCCAGCTCCAAGAATAATCTGTTC -3'
Posted On2020-10-20