Incidental Mutation 'R8433:Trim39'
ID653867
Institutional Source Beutler Lab
Gene Symbol Trim39
Ensembl Gene ENSMUSG00000045409
Gene Nametripartite motif-containing 39
SynonymsRnf23, RING-B box-coiled-coil-B30.2, RBCC-B30.2, tfp, 1100001D15Rik, E130103K13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8433 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location36258873-36272247 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36260705 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 387 (V387A)
Ref Sequence ENSEMBL: ENSMUSP00000133298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025319] [ENSMUST00000042717] [ENSMUST00000077535] [ENSMUST00000113706] [ENSMUST00000172573] [ENSMUST00000173369] [ENSMUST00000173665]
Predicted Effect probably benign
Transcript: ENSMUST00000025319
SMART Domains Protein: ENSMUSP00000025319
Gene: ENSMUSG00000024446

DomainStartEndE-ValueType
Pfam:Rpr2 13 96 1.2e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000042717
AA Change: V379A

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000039790
Gene: ENSMUSG00000045409
AA Change: V379A

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
RING 29 69 1.9e-10 SMART
BBOX 102 143 3.21e-8 SMART
coiled coil region 184 240 N/A INTRINSIC
PRY 306 359 2.3e-27 SMART
SPRY 360 485 1.95e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077535
SMART Domains Protein: ENSMUSP00000076739
Gene: ENSMUSG00000024446

DomainStartEndE-ValueType
low complexity region 28 42 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113706
AA Change: V379A

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109336
Gene: ENSMUSG00000045409
AA Change: V379A

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
RING 29 69 1.9e-10 SMART
BBOX 102 143 3.21e-8 SMART
coiled coil region 184 240 N/A INTRINSIC
PRY 306 359 2.3e-27 SMART
SPRY 360 485 1.95e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172573
SMART Domains Protein: ENSMUSP00000133400
Gene: ENSMUSG00000024446

DomainStartEndE-ValueType
Pfam:Rpr2 1 48 4.4e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173369
AA Change: V387A

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133298
Gene: ENSMUSG00000045409
AA Change: V387A

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
RING 29 69 1.9e-10 SMART
BBOX 102 143 3.21e-8 SMART
coiled coil region 184 240 N/A INTRINSIC
PRY 314 367 1.23e-27 SMART
SPRY 368 493 1.95e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173665
SMART Domains Protein: ENSMUSP00000133529
Gene: ENSMUSG00000045409

DomainStartEndE-ValueType
BBOX 1 40 5.81e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The function of this protein has not been identified. This gene lies within the major histocompatibility complex class I region on chromosome 6. Alternate splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Armh1 A G 4: 117,228,338 V227A probably benign Het
Cfhr1 A T 1: 139,557,538 Y57N probably damaging Het
Chtf18 A G 17: 25,726,944 S90P probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eral1 A G 11: 78,075,483 S290P probably benign Het
Foxk1 T C 5: 142,448,784 F268L probably benign Het
Gsta3 A G 1: 21,264,948 K218E probably benign Het
Mapk8ip2 G A 15: 89,457,866 A427T probably benign Het
Mtch2 T A 2: 90,847,161 probably benign Het
Ndufc1 A G 3: 51,408,890 L14P probably damaging Het
Olfr1055 G A 2: 86,346,800 P322L unknown Het
Olfr544 A T 7: 102,484,784 I112N probably benign Het
Olfr681 T C 7: 105,121,724 F89S probably damaging Het
Parn C A 16: 13,667,549 D28Y probably damaging Het
Phldb1 C T 9: 44,716,462 G229R probably damaging Het
Prpf3 A G 3: 95,851,651 V63A probably damaging Het
Ptger3 A C 3: 157,643,955 *363C probably null Het
Rnf6 A G 5: 146,211,278 V310A probably damaging Het
Scarf1 G A 11: 75,521,032 probably null Het
Slc5a6 G A 5: 31,037,462 A530V possibly damaging Het
Sorcs3 C T 19: 48,206,474 R99W possibly damaging Het
Svop A G 5: 114,032,761 C406R probably benign Het
Tnn G A 1: 160,097,220 S1452L possibly damaging Het
Tpx2 A G 2: 152,880,136 E216G probably damaging Het
Unc80 A T 1: 66,638,028 K2039* probably null Het
Vps13a A T 19: 16,741,236 L464I possibly damaging Het
Wdr35 G A 12: 9,008,495 D562N probably damaging Het
Zfp541 C T 7: 16,072,074 L45F probably benign Het
Zswim5 A G 4: 116,986,810 Y1015C possibly damaging Het
Other mutations in Trim39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Trim39 APN 17 36263963 splice site probably benign
IGL01462:Trim39 APN 17 36263725 splice site probably benign
IGL02243:Trim39 APN 17 36260384 missense probably damaging 1.00
IGL03390:Trim39 APN 17 36260571 missense probably damaging 0.99
barba UTSW 17 36268854 missense probably damaging 1.00
rossa UTSW 17 36260915 missense probably damaging 1.00
PIT4305001:Trim39 UTSW 17 36268970 missense possibly damaging 0.93
R0458:Trim39 UTSW 17 36261512 missense probably damaging 1.00
R0569:Trim39 UTSW 17 36263731 missense probably benign 0.36
R1565:Trim39 UTSW 17 36268854 missense probably damaging 1.00
R1769:Trim39 UTSW 17 36263940 missense probably damaging 1.00
R1969:Trim39 UTSW 17 36268753 missense probably benign 0.01
R2009:Trim39 UTSW 17 36263754 missense possibly damaging 0.92
R2568:Trim39 UTSW 17 36269164 unclassified probably benign
R5206:Trim39 UTSW 17 36260490 missense probably damaging 1.00
R5443:Trim39 UTSW 17 36260753 missense probably damaging 1.00
R6481:Trim39 UTSW 17 36268662 missense probably benign 0.03
R7132:Trim39 UTSW 17 36260655 missense probably benign 0.25
R7563:Trim39 UTSW 17 36260915 missense probably damaging 1.00
R7739:Trim39 UTSW 17 36260504 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- AGGTGTAGATATGTGAACGGTC -3'
(R):5'- TAACCTCGTCCTGTCAGAGG -3'

Sequencing Primer
(F):5'- CAGTGTGCCAGCCTCATAGTCTAG -3'
(R):5'- TCCTGTCAGAGGATCGGAAAAGC -3'
Posted On2020-10-20