Incidental Mutation 'R8434:Ivl'
ID 653881
Institutional Source Beutler Lab
Gene Symbol Ivl
Ensembl Gene ENSMUSG00000049128
Gene Name involucrin
Synonyms 1110019C06Rik
MMRRC Submission 067900-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8434 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 92478209-92481042 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 92479943 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 41 (T41S)
Ref Sequence ENSEMBL: ENSMUSP00000059780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053107]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053107
AA Change: T41S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000059780
Gene: ENSMUSG00000049128
AA Change: T41S

DomainStartEndE-ValueType
Pfam:Involucrin_N 1 67 2e-32 PFAM
Pfam:Involucrin2 94 134 1.3e-7 PFAM
Pfam:Involucrin2 173 211 1.9e-13 PFAM
Pfam:Involucrin2 210 249 4.1e-12 PFAM
Pfam:Involucrin2 239 278 2.9e-13 PFAM
Pfam:Involucrin2 268 306 4.1e-10 PFAM
Pfam:Involucrin2 311 351 4.6e-14 PFAM
Pfam:Involucrin2 343 376 1.3e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (57/57)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 137,773,021 (GRCm39) T737A probably damaging Het
2310034C09Rik A G 16: 88,556,260 (GRCm39) Y158C probably damaging Het
Abhd18 T A 3: 40,885,331 (GRCm39) S239T possibly damaging Het
Ankrd13b G A 11: 77,368,552 (GRCm39) T56I probably benign Het
Arhgef10l T A 4: 140,291,582 (GRCm39) Q454L possibly damaging Het
Atp1a2 T C 1: 172,112,179 (GRCm39) E572G probably benign Het
Cdk5rap2 T C 4: 70,282,257 (GRCm39) H164R probably benign Het
Clca4b A G 3: 144,631,917 (GRCm39) M196T probably benign Het
Cnbd1 T G 4: 19,055,045 (GRCm39) K127T probably benign Het
Cog3 A T 14: 75,979,836 (GRCm39) V165E probably damaging Het
Crim1 G A 17: 78,654,686 (GRCm39) R654H probably benign Het
Ctnnb1 G A 9: 120,786,628 (GRCm39) V617I possibly damaging Het
Dach1 T A 14: 98,406,129 (GRCm39) Q206L probably damaging Het
Dhx30 C T 9: 109,929,974 (GRCm39) V41I probably benign Het
Dnase2a T C 8: 85,636,410 (GRCm39) L176P probably damaging Het
Dpp10 T C 1: 123,360,739 (GRCm39) D262G probably damaging Het
Dsel T A 1: 111,789,385 (GRCm39) E383D probably damaging Het
Flt1 T A 5: 147,576,253 (GRCm39) Y585F probably damaging Het
Fubp1 T A 3: 151,926,190 (GRCm39) I304N probably damaging Het
Gab2 A G 7: 96,948,337 (GRCm39) D309G probably damaging Het
Gon4l T C 3: 88,762,086 (GRCm39) V291A probably damaging Het
Gpam C T 19: 55,070,063 (GRCm39) V398M possibly damaging Het
Grin3b C T 10: 79,810,422 (GRCm39) R643C probably damaging Het
Hdac3 T A 18: 38,074,475 (GRCm39) H339L possibly damaging Het
Hsdl2 A T 4: 59,610,621 (GRCm39) Q326L unknown Het
Insr T C 8: 3,215,514 (GRCm39) probably benign Het
Lama4 C T 10: 38,902,703 (GRCm39) P226S possibly damaging Het
Lpin1 A G 12: 16,613,621 (GRCm39) probably null Het
Lrrc42 A T 4: 107,104,721 (GRCm39) N81K probably damaging Het
Mast4 A T 13: 102,897,900 (GRCm39) H838Q probably damaging Het
Mcmdc2 A G 1: 9,990,806 (GRCm39) M314V possibly damaging Het
Me3 A G 7: 89,389,086 (GRCm39) E130G probably damaging Het
Mpnd A G 17: 56,316,405 (GRCm39) D28G possibly damaging Het
Mtch2 G T 2: 90,683,208 (GRCm39) E102* probably null Het
Myh13 A T 11: 67,254,011 (GRCm39) probably null Het
Or10ag55-ps1 G A 2: 87,114,978 (GRCm39) V115I probably benign Het
Or5ae2 C A 7: 84,506,497 (GRCm39) H309N probably benign Het
Plch2 T A 4: 155,074,192 (GRCm39) D891V probably damaging Het
Ppfibp2 T C 7: 107,327,957 (GRCm39) probably null Het
Rag1 A G 2: 101,473,009 (GRCm39) L711P probably damaging Het
Sacs T A 14: 61,450,636 (GRCm39) Y4227* probably null Het
Sec23ip C T 7: 128,352,151 (GRCm39) H176Y probably benign Het
Sema3a T C 5: 13,523,487 (GRCm39) probably null Het
Serpina10 C T 12: 103,594,563 (GRCm39) G219R probably damaging Het
Sp1 C T 15: 102,318,118 (GRCm39) L546F probably benign Het
Syne1 T C 10: 5,073,057 (GRCm39) N1256S probably benign Het
Tbc1d5 G T 17: 51,089,455 (GRCm39) probably benign Het
Tns1 T C 1: 73,964,765 (GRCm39) S33G probably benign Het
Tpsab1 A G 17: 25,564,445 (GRCm39) L3P possibly damaging Het
Trgv3 A G 13: 19,427,036 (GRCm39) T8A probably benign Het
Vav2 A T 2: 27,159,050 (GRCm39) probably benign Het
Vmn1r44 T C 6: 89,870,610 (GRCm39) S119P possibly damaging Het
Vmn2r31 A G 7: 7,387,699 (GRCm39) L624P probably damaging Het
Vps33a A T 5: 123,671,944 (GRCm39) W475R possibly damaging Het
Xpnpep3 G T 15: 81,311,795 (GRCm39) R167L possibly damaging Het
Zfhx4 T A 3: 5,463,918 (GRCm39) S1384T probably damaging Het
Zfp3 G A 11: 70,663,384 (GRCm39) E448K probably benign Het
Zfp362 T A 4: 128,679,769 (GRCm39) H299L probably damaging Het
Zfp664 C T 5: 124,962,827 (GRCm39) L74F possibly damaging Het
Zfp808 A G 13: 62,319,926 (GRCm39) Y385C probably damaging Het
Other mutations in Ivl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Ivl APN 3 92,479,819 (GRCm39) missense possibly damaging 0.68
IGL01656:Ivl APN 3 92,478,962 (GRCm39) nonsense probably null
IGL01820:Ivl APN 3 92,478,940 (GRCm39) missense possibly damaging 0.95
IGL03012:Ivl APN 3 92,479,733 (GRCm39) missense probably benign 0.01
PIT4142001:Ivl UTSW 3 92,479,608 (GRCm39) small deletion probably benign
PIT4151001:Ivl UTSW 3 92,479,608 (GRCm39) small deletion probably benign
PIT4458001:Ivl UTSW 3 92,479,608 (GRCm39) small insertion probably benign
R0256:Ivl UTSW 3 92,479,150 (GRCm39) missense probably damaging 1.00
R0276:Ivl UTSW 3 92,478,821 (GRCm39) missense unknown
R1800:Ivl UTSW 3 92,479,891 (GRCm39) missense unknown
R1940:Ivl UTSW 3 92,480,056 (GRCm39) missense probably benign 0.00
R1950:Ivl UTSW 3 92,479,420 (GRCm39) missense possibly damaging 0.85
R2887:Ivl UTSW 3 92,478,699 (GRCm39) missense unknown
R4457:Ivl UTSW 3 92,479,673 (GRCm39) missense probably benign 0.03
R4561:Ivl UTSW 3 92,479,262 (GRCm39) small insertion probably benign
R4562:Ivl UTSW 3 92,479,262 (GRCm39) small insertion probably benign
R4698:Ivl UTSW 3 92,478,698 (GRCm39) missense unknown
R4708:Ivl UTSW 3 92,479,057 (GRCm39) missense probably damaging 1.00
R4885:Ivl UTSW 3 92,479,718 (GRCm39) missense probably benign 0.03
R6354:Ivl UTSW 3 92,479,217 (GRCm39) small deletion probably benign
R6355:Ivl UTSW 3 92,479,217 (GRCm39) small deletion probably benign
R6356:Ivl UTSW 3 92,479,217 (GRCm39) small deletion probably benign
R6582:Ivl UTSW 3 92,479,217 (GRCm39) small deletion probably benign
R6723:Ivl UTSW 3 92,478,694 (GRCm39) missense unknown
R7091:Ivl UTSW 3 92,479,549 (GRCm39) missense possibly damaging 0.85
R7146:Ivl UTSW 3 92,479,538 (GRCm39) missense probably damaging 0.97
R7755:Ivl UTSW 3 92,479,317 (GRCm39) missense probably damaging 0.98
R7841:Ivl UTSW 3 92,479,699 (GRCm39) missense possibly damaging 0.52
R8048:Ivl UTSW 3 92,479,231 (GRCm39) missense probably damaging 1.00
R8171:Ivl UTSW 3 92,479,085 (GRCm39) missense probably damaging 1.00
R8363:Ivl UTSW 3 92,479,525 (GRCm39) missense possibly damaging 0.71
R8504:Ivl UTSW 3 92,480,078 (GRCm39) start gained probably benign
R8677:Ivl UTSW 3 92,479,986 (GRCm39) missense probably benign 0.00
R8688:Ivl UTSW 3 92,479,608 (GRCm39) small deletion probably benign
R8691:Ivl UTSW 3 92,478,823 (GRCm39) missense unknown
RF013:Ivl UTSW 3 92,479,650 (GRCm39) small deletion probably benign
RF031:Ivl UTSW 3 92,479,625 (GRCm39) frame shift probably null
RF036:Ivl UTSW 3 92,479,648 (GRCm39) frame shift probably null
RF038:Ivl UTSW 3 92,479,607 (GRCm39) small deletion probably benign
RF055:Ivl UTSW 3 92,479,607 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CCAGATGCAGTTCCTGTTCC -3'
(R):5'- TCAGTAGTAAGGATGTCAAGAACGC -3'

Sequencing Primer
(F):5'- AGTTCCTGTTCCTGCAGC -3'
(R):5'- GTATATTCTGTATGTTCAGCAGTTCC -3'
Posted On 2020-10-20