Incidental Mutation 'R8434:1110002E22Rik'
ID653882
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene NameRIKEN cDNA 1110002E22 gene
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.474) question?
Stock #R8434 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location138065052-138081506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138067260 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 737 (T737A)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]
Predicted Effect probably benign
Transcript: ENSMUST00000053318
Predicted Effect probably damaging
Transcript: ENSMUST00000163080
AA Change: T737A

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: T737A

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik A G 16: 88,759,372 Y158C probably damaging Het
Abhd18 T A 3: 40,930,896 S239T possibly damaging Het
Ankrd13b G A 11: 77,477,726 T56I probably benign Het
Arhgef10l T A 4: 140,564,271 Q454L possibly damaging Het
Atp1a2 T C 1: 172,284,612 E572G probably benign Het
Cdk5rap2 T C 4: 70,364,020 H164R probably benign Het
Clca4b A G 3: 144,926,156 M196T probably benign Het
Cnbd1 T G 4: 19,055,045 K127T probably benign Het
Cog3 A T 14: 75,742,396 V165E probably damaging Het
Crim1 G A 17: 78,347,257 R654H probably benign Het
Ctnnb1 G A 9: 120,957,562 V617I possibly damaging Het
Dach1 T A 14: 98,168,693 Q206L probably damaging Het
Dhx30 C T 9: 110,100,906 V41I probably benign Het
Dnase2a T C 8: 84,909,781 L176P probably damaging Het
Dpp10 T C 1: 123,433,010 D262G probably damaging Het
Dsel T A 1: 111,861,655 E383D probably damaging Het
Flt1 T A 5: 147,639,443 Y585F probably damaging Het
Fubp1 T A 3: 152,220,553 I304N probably damaging Het
Gab2 A G 7: 97,299,130 D309G probably damaging Het
Gon4l T C 3: 88,854,779 V291A probably damaging Het
Gpam C T 19: 55,081,631 V398M possibly damaging Het
Grin3b C T 10: 79,974,588 R643C probably damaging Het
Hdac3 T A 18: 37,941,422 H339L possibly damaging Het
Hsdl2 A T 4: 59,610,621 Q326L unknown Het
Ivl T A 3: 92,572,636 T41S probably benign Het
Lama4 C T 10: 39,026,707 P226S possibly damaging Het
Lpin1 A G 12: 16,563,620 probably null Het
Lrrc42 A T 4: 107,247,524 N81K probably damaging Het
Mast4 A T 13: 102,761,392 H838Q probably damaging Het
Mcmdc2 A G 1: 9,920,581 M314V possibly damaging Het
Me3 A G 7: 89,739,878 E130G probably damaging Het
Mpnd A G 17: 56,009,405 D28G possibly damaging Het
Mtch2 G T 2: 90,852,864 E102* probably null Het
Myh13 A T 11: 67,363,185 probably null Het
Olfr1117-ps1 G A 2: 87,284,634 V115I probably benign Het
Olfr291 C A 7: 84,857,289 H309N probably benign Het
Plch2 T A 4: 154,989,735 D891V probably damaging Het
Ppfibp2 T C 7: 107,728,750 probably null Het
Rag1 A G 2: 101,642,664 L711P probably damaging Het
Sacs T A 14: 61,213,187 Y4227* probably null Het
Sec23ip C T 7: 128,750,427 H176Y probably benign Het
Sema3a T C 5: 13,473,520 probably null Het
Sp1 C T 15: 102,409,683 L546F probably benign Het
Syne1 T C 10: 5,123,057 N1256S probably benign Het
Tcrg-V3 A G 13: 19,242,866 T8A probably benign Het
Tns1 T C 1: 73,925,606 S33G probably benign Het
Tpsab1 A G 17: 25,345,471 L3P possibly damaging Het
Vmn1r44 T C 6: 89,893,628 S119P possibly damaging Het
Vmn2r31 A G 7: 7,384,700 L624P probably damaging Het
Vps33a A T 5: 123,533,881 W475R possibly damaging Het
Xpnpep3 G T 15: 81,427,594 R167L possibly damaging Het
Zfhx4 T A 3: 5,398,858 S1384T probably damaging Het
Zfp3 G A 11: 70,772,558 E448K probably benign Het
Zfp362 T A 4: 128,785,976 H299L probably damaging Het
Zfp664 C T 5: 124,885,763 L74F possibly damaging Het
Zfp808 A G 13: 62,172,112 Y385C probably damaging Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion probably benign
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
R6092:1110002E22Rik UTSW 3 138068940 missense probably benign 0.02
R6305:1110002E22Rik UTSW 3 138067980 missense probably damaging 1.00
R6457:1110002E22Rik UTSW 3 138066622 missense probably damaging 1.00
R6469:1110002E22Rik UTSW 3 138066975 missense probably damaging 0.97
R6499:1110002E22Rik UTSW 3 138068800 missense probably damaging 1.00
R6527:1110002E22Rik UTSW 3 138067527 missense probably damaging 0.99
R6580:1110002E22Rik UTSW 3 138066625 missense probably benign 0.00
R6693:1110002E22Rik UTSW 3 138069154 missense probably benign 0.00
R6751:1110002E22Rik UTSW 3 138066210 missense probably damaging 1.00
R6852:1110002E22Rik UTSW 3 138065169 nonsense probably null
R6920:1110002E22Rik UTSW 3 138068050 missense probably damaging 1.00
R7001:1110002E22Rik UTSW 3 138065511 missense probably benign
R7145:1110002E22Rik UTSW 3 138070059 missense probably damaging 1.00
R7238:1110002E22Rik UTSW 3 138069951 missense probably damaging 1.00
R7278:1110002E22Rik UTSW 3 138065476 missense probably benign
R7425:1110002E22Rik UTSW 3 138065695 missense probably benign 0.00
R7487:1110002E22Rik UTSW 3 138066868 missense probably damaging 1.00
R7557:1110002E22Rik UTSW 3 138068283 nonsense probably null
R7663:1110002E22Rik UTSW 3 138066126 missense probably damaging 0.98
R7743:1110002E22Rik UTSW 3 138068755 missense probably damaging 1.00
R7799:1110002E22Rik UTSW 3 138069601 missense probably benign 0.33
R8181:1110002E22Rik UTSW 3 138068395 missense probably damaging 0.99
R8264:1110002E22Rik UTSW 3 138067782 missense probably damaging 0.99
R8273:1110002E22Rik UTSW 3 138066450 missense probably benign
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGGTCAACCTTCCTGGAC -3'
(R):5'- GGCTGGAAGCGAATTTGGAC -3'

Sequencing Primer
(F):5'- ACCTTCCTGGACTTAAAATGTGGAGG -3'
(R):5'- CTGGAAGCGAATTTGGACTTCTTC -3'
Posted On2020-10-20