Incidental Mutation 'R8434:Cdk5rap2'
ID 653887
Institutional Source Beutler Lab
Gene Symbol Cdk5rap2
Ensembl Gene ENSMUSG00000039298
Gene Name CDK5 regulatory subunit associated protein 2
Synonyms an, 2900018K03Rik
MMRRC Submission 067900-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.392) question?
Stock # R8434 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 70135092-70328672 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70282257 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 164 (H164R)
Ref Sequence ENSEMBL: ENSMUSP00000119891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076541] [ENSMUST00000144099]
AlphaFold Q8K389
Predicted Effect probably benign
Transcript: ENSMUST00000076541
Predicted Effect probably benign
Transcript: ENSMUST00000144099
AA Change: H164R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119891
Gene: ENSMUSG00000039298
AA Change: H164R

DomainStartEndE-ValueType
Pfam:Cnn_1N 58 130 3.6e-26 PFAM
coiled coil region 210 345 N/A INTRINSIC
low complexity region 368 381 N/A INTRINSIC
coiled coil region 388 462 N/A INTRINSIC
coiled coil region 569 616 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
coiled coil region 960 1001 N/A INTRINSIC
coiled coil region 1112 1140 N/A INTRINSIC
coiled coil region 1200 1237 N/A INTRINSIC
Blast:BRLZ 1479 1535 6e-13 BLAST
low complexity region 1548 1565 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
low complexity region 1700 1711 N/A INTRINSIC
low complexity region 1811 1822 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of CDK5 (cyclin-dependent kinase 5) activity. The protein encoded by this gene is localized to the centrosome and Golgi complex, interacts with CDK5R1 and pericentrin (PCNT), plays a role in centriole engagement and microtubule nucleation, and has been linked to primary microcephaly and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutant phenotype varies by strain background. Severely affected mutants exhibit small size, severe anemia, and neonatal death. Mildly affected mutants are viable with mild macrocytic anemia, reduced fertility and radiation senstitivity. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, other(1) Gene trapped(20) Radiation induced(1)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 137,773,021 (GRCm39) T737A probably damaging Het
2310034C09Rik A G 16: 88,556,260 (GRCm39) Y158C probably damaging Het
Abhd18 T A 3: 40,885,331 (GRCm39) S239T possibly damaging Het
Ankrd13b G A 11: 77,368,552 (GRCm39) T56I probably benign Het
Arhgef10l T A 4: 140,291,582 (GRCm39) Q454L possibly damaging Het
Atp1a2 T C 1: 172,112,179 (GRCm39) E572G probably benign Het
Clca4b A G 3: 144,631,917 (GRCm39) M196T probably benign Het
Cnbd1 T G 4: 19,055,045 (GRCm39) K127T probably benign Het
Cog3 A T 14: 75,979,836 (GRCm39) V165E probably damaging Het
Crim1 G A 17: 78,654,686 (GRCm39) R654H probably benign Het
Ctnnb1 G A 9: 120,786,628 (GRCm39) V617I possibly damaging Het
Dach1 T A 14: 98,406,129 (GRCm39) Q206L probably damaging Het
Dhx30 C T 9: 109,929,974 (GRCm39) V41I probably benign Het
Dnase2a T C 8: 85,636,410 (GRCm39) L176P probably damaging Het
Dpp10 T C 1: 123,360,739 (GRCm39) D262G probably damaging Het
Dsel T A 1: 111,789,385 (GRCm39) E383D probably damaging Het
Flt1 T A 5: 147,576,253 (GRCm39) Y585F probably damaging Het
Fubp1 T A 3: 151,926,190 (GRCm39) I304N probably damaging Het
Gab2 A G 7: 96,948,337 (GRCm39) D309G probably damaging Het
Gon4l T C 3: 88,762,086 (GRCm39) V291A probably damaging Het
Gpam C T 19: 55,070,063 (GRCm39) V398M possibly damaging Het
Grin3b C T 10: 79,810,422 (GRCm39) R643C probably damaging Het
Hdac3 T A 18: 38,074,475 (GRCm39) H339L possibly damaging Het
Hsdl2 A T 4: 59,610,621 (GRCm39) Q326L unknown Het
Insr T C 8: 3,215,514 (GRCm39) probably benign Het
Ivl T A 3: 92,479,943 (GRCm39) T41S probably benign Het
Lama4 C T 10: 38,902,703 (GRCm39) P226S possibly damaging Het
Lpin1 A G 12: 16,613,621 (GRCm39) probably null Het
Lrrc42 A T 4: 107,104,721 (GRCm39) N81K probably damaging Het
Mast4 A T 13: 102,897,900 (GRCm39) H838Q probably damaging Het
Mcmdc2 A G 1: 9,990,806 (GRCm39) M314V possibly damaging Het
Me3 A G 7: 89,389,086 (GRCm39) E130G probably damaging Het
Mpnd A G 17: 56,316,405 (GRCm39) D28G possibly damaging Het
Mtch2 G T 2: 90,683,208 (GRCm39) E102* probably null Het
Myh13 A T 11: 67,254,011 (GRCm39) probably null Het
Or10ag55-ps1 G A 2: 87,114,978 (GRCm39) V115I probably benign Het
Or5ae2 C A 7: 84,506,497 (GRCm39) H309N probably benign Het
Plch2 T A 4: 155,074,192 (GRCm39) D891V probably damaging Het
Ppfibp2 T C 7: 107,327,957 (GRCm39) probably null Het
Rag1 A G 2: 101,473,009 (GRCm39) L711P probably damaging Het
Sacs T A 14: 61,450,636 (GRCm39) Y4227* probably null Het
Sec23ip C T 7: 128,352,151 (GRCm39) H176Y probably benign Het
Sema3a T C 5: 13,523,487 (GRCm39) probably null Het
Serpina10 C T 12: 103,594,563 (GRCm39) G219R probably damaging Het
Sp1 C T 15: 102,318,118 (GRCm39) L546F probably benign Het
Syne1 T C 10: 5,073,057 (GRCm39) N1256S probably benign Het
Tbc1d5 G T 17: 51,089,455 (GRCm39) probably benign Het
Tns1 T C 1: 73,964,765 (GRCm39) S33G probably benign Het
Tpsab1 A G 17: 25,564,445 (GRCm39) L3P possibly damaging Het
Trgv3 A G 13: 19,427,036 (GRCm39) T8A probably benign Het
Vav2 A T 2: 27,159,050 (GRCm39) probably benign Het
Vmn1r44 T C 6: 89,870,610 (GRCm39) S119P possibly damaging Het
Vmn2r31 A G 7: 7,387,699 (GRCm39) L624P probably damaging Het
Vps33a A T 5: 123,671,944 (GRCm39) W475R possibly damaging Het
Xpnpep3 G T 15: 81,311,795 (GRCm39) R167L possibly damaging Het
Zfhx4 T A 3: 5,463,918 (GRCm39) S1384T probably damaging Het
Zfp3 G A 11: 70,663,384 (GRCm39) E448K probably benign Het
Zfp362 T A 4: 128,679,769 (GRCm39) H299L probably damaging Het
Zfp664 C T 5: 124,962,827 (GRCm39) L74F possibly damaging Het
Zfp808 A G 13: 62,319,926 (GRCm39) Y385C probably damaging Het
Other mutations in Cdk5rap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cdk5rap2 APN 4 70,321,709 (GRCm39) critical splice donor site probably null
IGL01305:Cdk5rap2 APN 4 70,298,472 (GRCm39) missense possibly damaging 0.52
IGL01987:Cdk5rap2 APN 4 70,220,319 (GRCm39) critical splice donor site probably null
IGL02213:Cdk5rap2 APN 4 70,235,839 (GRCm39) splice site probably benign
IGL02732:Cdk5rap2 APN 4 70,184,902 (GRCm39) nonsense probably null
IGL03063:Cdk5rap2 APN 4 70,273,114 (GRCm39) critical splice acceptor site probably null
IGL03244:Cdk5rap2 APN 4 70,199,672 (GRCm39) missense probably benign 0.19
ANU22:Cdk5rap2 UTSW 4 70,298,472 (GRCm39) missense possibly damaging 0.52
F5426:Cdk5rap2 UTSW 4 70,173,040 (GRCm39) missense probably benign
R0010:Cdk5rap2 UTSW 4 70,161,696 (GRCm39) missense probably benign 0.01
R0010:Cdk5rap2 UTSW 4 70,161,696 (GRCm39) missense probably benign 0.01
R0044:Cdk5rap2 UTSW 4 70,279,138 (GRCm39) missense probably damaging 1.00
R0044:Cdk5rap2 UTSW 4 70,279,138 (GRCm39) missense probably damaging 1.00
R0482:Cdk5rap2 UTSW 4 70,328,506 (GRCm39) start gained probably benign
R0548:Cdk5rap2 UTSW 4 70,267,379 (GRCm39) critical splice donor site probably null
R0594:Cdk5rap2 UTSW 4 70,273,050 (GRCm39) missense probably damaging 0.98
R0737:Cdk5rap2 UTSW 4 70,255,612 (GRCm39) missense probably benign 0.01
R0788:Cdk5rap2 UTSW 4 70,225,468 (GRCm39) missense possibly damaging 0.90
R0960:Cdk5rap2 UTSW 4 70,161,745 (GRCm39) missense probably benign 0.03
R1682:Cdk5rap2 UTSW 4 70,220,387 (GRCm39) missense possibly damaging 0.92
R1727:Cdk5rap2 UTSW 4 70,208,209 (GRCm39) missense possibly damaging 0.70
R1727:Cdk5rap2 UTSW 4 70,190,916 (GRCm39) missense probably benign
R1768:Cdk5rap2 UTSW 4 70,225,470 (GRCm39) missense probably benign 0.09
R1903:Cdk5rap2 UTSW 4 70,321,791 (GRCm39) splice site probably null
R2270:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2271:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2272:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2364:Cdk5rap2 UTSW 4 70,279,046 (GRCm39) critical splice donor site probably null
R2763:Cdk5rap2 UTSW 4 70,199,508 (GRCm39) missense probably benign
R2893:Cdk5rap2 UTSW 4 70,208,110 (GRCm39) missense probably benign
R2894:Cdk5rap2 UTSW 4 70,208,110 (GRCm39) missense probably benign
R2958:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2959:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2961:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2962:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2963:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R3522:Cdk5rap2 UTSW 4 70,168,647 (GRCm39) missense probably damaging 1.00
R3725:Cdk5rap2 UTSW 4 70,153,674 (GRCm39) missense possibly damaging 0.89
R3726:Cdk5rap2 UTSW 4 70,153,674 (GRCm39) missense possibly damaging 0.89
R3876:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R3919:Cdk5rap2 UTSW 4 70,298,460 (GRCm39) missense possibly damaging 0.50
R4025:Cdk5rap2 UTSW 4 70,168,624 (GRCm39) missense probably damaging 0.98
R4324:Cdk5rap2 UTSW 4 70,271,851 (GRCm39) missense probably damaging 1.00
R4485:Cdk5rap2 UTSW 4 70,157,520 (GRCm39) critical splice donor site probably null
R4516:Cdk5rap2 UTSW 4 70,194,952 (GRCm39) splice site probably null
R4556:Cdk5rap2 UTSW 4 70,157,549 (GRCm39) missense probably damaging 0.97
R4560:Cdk5rap2 UTSW 4 70,233,568 (GRCm39) missense probably benign 0.03
R4584:Cdk5rap2 UTSW 4 70,184,997 (GRCm39) missense probably damaging 1.00
R4620:Cdk5rap2 UTSW 4 70,184,943 (GRCm39) missense probably benign 0.00
R4639:Cdk5rap2 UTSW 4 70,220,413 (GRCm39) missense probably damaging 0.97
R4755:Cdk5rap2 UTSW 4 70,156,662 (GRCm39) missense probably damaging 1.00
R4947:Cdk5rap2 UTSW 4 70,146,829 (GRCm39) splice site probably null
R5116:Cdk5rap2 UTSW 4 70,225,475 (GRCm39) missense possibly damaging 0.67
R5449:Cdk5rap2 UTSW 4 70,194,888 (GRCm39) missense probably benign 0.00
R5643:Cdk5rap2 UTSW 4 70,184,970 (GRCm39) missense probably damaging 0.99
R5899:Cdk5rap2 UTSW 4 70,161,830 (GRCm39) splice site probably benign
R6177:Cdk5rap2 UTSW 4 70,199,719 (GRCm39) missense probably damaging 0.99
R6254:Cdk5rap2 UTSW 4 70,282,269 (GRCm39) missense probably damaging 1.00
R6326:Cdk5rap2 UTSW 4 70,153,691 (GRCm39) missense probably damaging 1.00
R6335:Cdk5rap2 UTSW 4 70,184,849 (GRCm39) missense possibly damaging 0.79
R6534:Cdk5rap2 UTSW 4 70,273,050 (GRCm39) missense probably damaging 0.98
R6857:Cdk5rap2 UTSW 4 70,163,633 (GRCm39) nonsense probably null
R6959:Cdk5rap2 UTSW 4 70,278,906 (GRCm39) splice site probably null
R7104:Cdk5rap2 UTSW 4 70,267,393 (GRCm39) missense probably benign 0.00
R7145:Cdk5rap2 UTSW 4 70,156,468 (GRCm39) missense probably benign 0.13
R7223:Cdk5rap2 UTSW 4 70,153,684 (GRCm39) missense probably benign 0.02
R7234:Cdk5rap2 UTSW 4 70,295,024 (GRCm39) splice site probably null
R7240:Cdk5rap2 UTSW 4 70,210,145 (GRCm39) missense probably damaging 1.00
R7247:Cdk5rap2 UTSW 4 70,255,666 (GRCm39) missense probably damaging 1.00
R7382:Cdk5rap2 UTSW 4 70,208,262 (GRCm39) missense probably benign 0.19
R7413:Cdk5rap2 UTSW 4 70,172,972 (GRCm39) missense probably damaging 1.00
R7576:Cdk5rap2 UTSW 4 70,185,109 (GRCm39) missense probably benign 0.01
R8236:Cdk5rap2 UTSW 4 70,160,722 (GRCm39) missense probably benign
R8688:Cdk5rap2 UTSW 4 70,298,510 (GRCm39) missense probably damaging 1.00
R8706:Cdk5rap2 UTSW 4 70,157,562 (GRCm39) missense probably benign 0.08
R8731:Cdk5rap2 UTSW 4 70,163,747 (GRCm39) splice site probably benign
R8782:Cdk5rap2 UTSW 4 70,161,712 (GRCm39) missense possibly damaging 0.57
R8855:Cdk5rap2 UTSW 4 70,218,887 (GRCm39) missense probably damaging 1.00
R8965:Cdk5rap2 UTSW 4 70,185,042 (GRCm39) missense probably benign 0.30
R9242:Cdk5rap2 UTSW 4 70,255,583 (GRCm39) missense possibly damaging 0.46
R9308:Cdk5rap2 UTSW 4 70,328,504 (GRCm39) start codon destroyed probably null 0.99
R9396:Cdk5rap2 UTSW 4 70,182,895 (GRCm39) missense probably damaging 0.97
R9396:Cdk5rap2 UTSW 4 70,172,903 (GRCm39) missense possibly damaging 0.75
R9507:Cdk5rap2 UTSW 4 70,210,110 (GRCm39) missense probably benign
Z1176:Cdk5rap2 UTSW 4 70,184,980 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTAAAGTGCCTACAGAGAGGC -3'
(R):5'- GTTCTATAAATGGGAGCAGTGAC -3'

Sequencing Primer
(F):5'- TGCCTACAGAGAGGCTAGAATCC -3'
(R):5'- GTGACTGGCAAATACCCCTTG -3'
Posted On 2020-10-20