Mutagenetix > Incidental Mutation

Incidental Mutation 'R8434:Cdk5rap2'

653887

Institutional Source

Beutler Lab

Gene Symbol

Cdk5rap2

Ensembl Gene

ENSMUSG00000039298

Gene Name

CDK5 regulatory subunit associated protein 2

Synonyms

2900018K03Rik, an

MMRRC Submission

Accession Numbers

Genbank: NM_145990.3

Essential gene?

Possibly non essential (E-score: 0.406) question?

Stock #

R8434 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70216856-70410443 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70364020 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 164 (H164R)

Ref Sequence

ENSEMBL: ENSMUSP00000119891 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076541] [ENSMUST00000144099]

AlphaFold

Q8K389

Predicted Effect

probably benign
Transcript: ENSMUST00000076541

Predicted Effect

probably benign
Transcript: ENSMUST00000144099
AA Change: H164R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000119891
Gene: ENSMUSG00000039298
AA Change: H164R

Domain	Start	End	E-Value	Type
Pfam:Cnn_1N	58	130	3.6e-26	PFAM
coiled coil region	210	345	N/A	INTRINSIC
low complexity region	368	381	N/A	INTRINSIC
coiled coil region	388	462	N/A	INTRINSIC
coiled coil region	569	616	N/A	INTRINSIC
low complexity region	761	776	N/A	INTRINSIC
low complexity region	791	800	N/A	INTRINSIC
coiled coil region	960	1001	N/A	INTRINSIC
coiled coil region	1112	1140	N/A	INTRINSIC
coiled coil region	1200	1237	N/A	INTRINSIC
Blast:BRLZ	1479	1535	6e-13	BLAST
low complexity region	1548	1565	N/A	INTRINSIC
low complexity region	1619	1637	N/A	INTRINSIC
low complexity region	1700	1711	N/A	INTRINSIC
low complexity region	1811	1822	N/A	INTRINSIC

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of CDK5 (cyclin-dependent kinase 5) activity. The protein encoded by this gene is localized to the centrosome and Golgi complex, interacts with CDK5R1 and pericentrin (PCNT), plays a role in centriole engagement and microtubule nucleation, and has been linked to primary microcephaly and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutant phenotype varies by strain background. Severely affected mutants exhibit small size, severe anemia, and neonatal death. Mildly affected mutants are viable with mild macrocytic anemia, reduced fertility and radiation senstitivity. [provided by MGI curators]

Allele List at MGI

All alleles(22) : Targeted, other(1) Gene trapped(20) Radiation induced(1)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,067,260	T737A	probably damaging	Het
2310034C09Rik	A	G	16: 88,759,372	Y158C	probably damaging	Het
Abhd18	T	A	3: 40,930,896	S239T	possibly damaging	Het
Ankrd13b	G	A	11: 77,477,726	T56I	probably benign	Het
Arhgef10l	T	A	4: 140,564,271	Q454L	possibly damaging	Het
Atp1a2	T	C	1: 172,284,612	E572G	probably benign	Het
Clca4b	A	G	3: 144,926,156	M196T	probably benign	Het
Cnbd1	T	G	4: 19,055,045	K127T	probably benign	Het
Cog3	A	T	14: 75,742,396	V165E	probably damaging	Het
Crim1	G	A	17: 78,347,257	R654H	probably benign	Het
Ctnnb1	G	A	9: 120,957,562	V617I	possibly damaging	Het
Dach1	T	A	14: 98,168,693	Q206L	probably damaging	Het
Dhx30	C	T	9: 110,100,906	V41I	probably benign	Het
Dnase2a	T	C	8: 84,909,781	L176P	probably damaging	Het
Dpp10	T	C	1: 123,433,010	D262G	probably damaging	Het
Dsel	T	A	1: 111,861,655	E383D	probably damaging	Het
Flt1	T	A	5: 147,639,443	Y585F	probably damaging	Het
Fubp1	T	A	3: 152,220,553	I304N	probably damaging	Het
Gab2	A	G	7: 97,299,130	D309G	probably damaging	Het
Gon4l	T	C	3: 88,854,779	V291A	probably damaging	Het
Gpam	C	T	19: 55,081,631	V398M	possibly damaging	Het
Grin3b	C	T	10: 79,974,588	R643C	probably damaging	Het
Hdac3	T	A	18: 37,941,422	H339L	possibly damaging	Het
Hsdl2	A	T	4: 59,610,621	Q326L	unknown	Het
Insr	T	C	8: 3,165,514		probably benign	Het
Ivl	T	A	3: 92,572,636	T41S	probably benign	Het
Lama4	C	T	10: 39,026,707	P226S	possibly damaging	Het
Lpin1	A	G	12: 16,563,620		probably null	Het
Lrrc42	A	T	4: 107,247,524	N81K	probably damaging	Het
Mast4	A	T	13: 102,761,392	H838Q	probably damaging	Het
Mcmdc2	A	G	1: 9,920,581	M314V	possibly damaging	Het
Me3	A	G	7: 89,739,878	E130G	probably damaging	Het
Mpnd	A	G	17: 56,009,405	D28G	possibly damaging	Het
Mtch2	G	T	2: 90,852,864	E102*	probably null	Het
Myh13	A	T	11: 67,363,185		probably null	Het
Olfr1117-ps1	G	A	2: 87,284,634	V115I	probably benign	Het
Olfr291	C	A	7: 84,857,289	H309N	probably benign	Het
Plch2	T	A	4: 154,989,735	D891V	probably damaging	Het
Ppfibp2	T	C	7: 107,728,750		probably null	Het
Rag1	A	G	2: 101,642,664	L711P	probably damaging	Het
Sacs	T	A	14: 61,213,187	Y4227*	probably null	Het
Sec23ip	C	T	7: 128,750,427	H176Y	probably benign	Het
Sema3a	T	C	5: 13,473,520		probably null	Het
Serpina10	C	T	12: 103,628,304	G219R	probably damaging	Het
Sp1	C	T	15: 102,409,683	L546F	probably benign	Het
Syne1	T	C	10: 5,123,057	N1256S	probably benign	Het
Tbc1d5	G	T	17: 50,782,427		probably benign	Het
Tcrg-V3	A	G	13: 19,242,866	T8A	probably benign	Het
Tns1	T	C	1: 73,925,606	S33G	probably benign	Het
Tpsab1	A	G	17: 25,345,471	L3P	possibly damaging	Het
Vav2	A	T	2: 27,269,038		probably benign	Het
Vmn1r44	T	C	6: 89,893,628	S119P	possibly damaging	Het
Vmn2r31	A	G	7: 7,384,700	L624P	probably damaging	Het
Vps33a	A	T	5: 123,533,881	W475R	possibly damaging	Het
Xpnpep3	G	T	15: 81,427,594	R167L	possibly damaging	Het
Zfhx4	T	A	3: 5,398,858	S1384T	probably damaging	Het
Zfp3	G	A	11: 70,772,558	E448K	probably benign	Het
Zfp362	T	A	4: 128,785,976	H299L	probably damaging	Het
Zfp664	C	T	5: 124,885,763	L74F	possibly damaging	Het
Zfp808	A	G	13: 62,172,112	Y385C	probably damaging	Het

Other mutations in Cdk5rap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Cdk5rap2	APN	4	70403472	critical splice donor site	probably null
IGL01305:Cdk5rap2	APN	4	70380235	missense	possibly damaging	0.52
IGL01987:Cdk5rap2	APN	4	70302082	critical splice donor site	probably null
IGL02213:Cdk5rap2	APN	4	70317602	splice site	probably benign
IGL02732:Cdk5rap2	APN	4	70266665	nonsense	probably null
IGL03063:Cdk5rap2	APN	4	70354877	critical splice acceptor site	probably null
IGL03244:Cdk5rap2	APN	4	70281435	missense	probably benign	0.19
ANU22:Cdk5rap2	UTSW	4	70380235	missense	possibly damaging	0.52
F5426:Cdk5rap2	UTSW	4	70254803	missense	probably benign
R0010:Cdk5rap2	UTSW	4	70243459	missense	probably benign	0.01
R0010:Cdk5rap2	UTSW	4	70243459	missense	probably benign	0.01
R0044:Cdk5rap2	UTSW	4	70360901	missense	probably damaging	1.00
R0044:Cdk5rap2	UTSW	4	70360901	missense	probably damaging	1.00
R0482:Cdk5rap2	UTSW	4	70410269	start gained	probably benign
R0548:Cdk5rap2	UTSW	4	70349142	critical splice donor site	probably null
R0594:Cdk5rap2	UTSW	4	70354813	missense	probably damaging	0.98
R0737:Cdk5rap2	UTSW	4	70337375	missense	probably benign	0.01
R0788:Cdk5rap2	UTSW	4	70307231	missense	possibly damaging	0.90
R0960:Cdk5rap2	UTSW	4	70243508	missense	probably benign	0.03
R1682:Cdk5rap2	UTSW	4	70302150	missense	possibly damaging	0.92
R1727:Cdk5rap2	UTSW	4	70272679	missense	probably benign
R1727:Cdk5rap2	UTSW	4	70289972	missense	possibly damaging	0.70
R1768:Cdk5rap2	UTSW	4	70307233	missense	probably benign	0.09
R1903:Cdk5rap2	UTSW	4	70403554	splice site	probably null
R2270:Cdk5rap2	UTSW	4	70266678	missense	probably benign	0.01
R2271:Cdk5rap2	UTSW	4	70266678	missense	probably benign	0.01
R2272:Cdk5rap2	UTSW	4	70266678	missense	probably benign	0.01
R2364:Cdk5rap2	UTSW	4	70360809	critical splice donor site	probably null
R2763:Cdk5rap2	UTSW	4	70281271	missense	probably benign
R2893:Cdk5rap2	UTSW	4	70289873	missense	probably benign
R2894:Cdk5rap2	UTSW	4	70289873	missense	probably benign
R2958:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R2959:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R2961:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R2962:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R2963:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R3522:Cdk5rap2	UTSW	4	70250410	missense	probably damaging	1.00
R3725:Cdk5rap2	UTSW	4	70235437	missense	possibly damaging	0.89
R3726:Cdk5rap2	UTSW	4	70235437	missense	possibly damaging	0.89
R3876:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R3919:Cdk5rap2	UTSW	4	70380223	missense	possibly damaging	0.50
R4025:Cdk5rap2	UTSW	4	70250387	missense	probably damaging	0.98
R4324:Cdk5rap2	UTSW	4	70353614	missense	probably damaging	1.00
R4485:Cdk5rap2	UTSW	4	70239283	critical splice donor site	probably null
R4516:Cdk5rap2	UTSW	4	70276715	splice site	probably null
R4556:Cdk5rap2	UTSW	4	70239312	missense	probably damaging	0.97
R4560:Cdk5rap2	UTSW	4	70315331	missense	probably benign	0.03
R4584:Cdk5rap2	UTSW	4	70266760	missense	probably damaging	1.00
R4620:Cdk5rap2	UTSW	4	70266706	missense	probably benign	0.00
R4639:Cdk5rap2	UTSW	4	70302176	missense	probably damaging	0.97
R4755:Cdk5rap2	UTSW	4	70238425	missense	probably damaging	1.00
R4947:Cdk5rap2	UTSW	4	70228592	splice site	probably null
R5116:Cdk5rap2	UTSW	4	70307238	missense	possibly damaging	0.67
R5449:Cdk5rap2	UTSW	4	70276651	missense	probably benign	0.00
R5643:Cdk5rap2	UTSW	4	70266733	missense	probably damaging	0.99
R5899:Cdk5rap2	UTSW	4	70243593	splice site	probably benign
R6177:Cdk5rap2	UTSW	4	70281482	missense	probably damaging	0.99
R6254:Cdk5rap2	UTSW	4	70364032	missense	probably damaging	1.00
R6326:Cdk5rap2	UTSW	4	70235454	missense	probably damaging	1.00
R6335:Cdk5rap2	UTSW	4	70266612	missense	possibly damaging	0.79
R6534:Cdk5rap2	UTSW	4	70354813	missense	probably damaging	0.98
R6857:Cdk5rap2	UTSW	4	70245396	nonsense	probably null
R6959:Cdk5rap2	UTSW	4	70360669	splice site	probably null
R7104:Cdk5rap2	UTSW	4	70349156	missense	probably benign	0.00
R7145:Cdk5rap2	UTSW	4	70238231	missense	probably benign	0.13
R7223:Cdk5rap2	UTSW	4	70235447	missense	probably benign	0.02
R7234:Cdk5rap2	UTSW	4	70376787	splice site	probably null
R7240:Cdk5rap2	UTSW	4	70291908	missense	probably damaging	1.00
R7247:Cdk5rap2	UTSW	4	70337429	missense	probably damaging	1.00
R7382:Cdk5rap2	UTSW	4	70290025	missense	probably benign	0.19
R7413:Cdk5rap2	UTSW	4	70254735	missense	probably damaging	1.00
R7576:Cdk5rap2	UTSW	4	70266872	missense	probably benign	0.01
R8236:Cdk5rap2	UTSW	4	70242485	missense	probably benign
R8688:Cdk5rap2	UTSW	4	70380273	missense	probably damaging	1.00
R8706:Cdk5rap2	UTSW	4	70239325	missense	probably benign	0.08
R8731:Cdk5rap2	UTSW	4	70245510	splice site	probably benign
R8782:Cdk5rap2	UTSW	4	70243475	missense	possibly damaging	0.57
R8855:Cdk5rap2	UTSW	4	70300650	missense	probably damaging	1.00
R8965:Cdk5rap2	UTSW	4	70266805	missense	probably benign	0.30
R9242:Cdk5rap2	UTSW	4	70337346	missense	possibly damaging	0.46
R9308:Cdk5rap2	UTSW	4	70410267	start codon destroyed	probably null	0.99
R9396:Cdk5rap2	UTSW	4	70254666	missense	possibly damaging	0.75
R9396:Cdk5rap2	UTSW	4	70264658	missense	probably damaging	0.97
R9507:Cdk5rap2	UTSW	4	70291873	missense	probably benign
Z1176:Cdk5rap2	UTSW	4	70266743	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGTAAAGTGCCTACAGAGAGGC -3'
(R):5'- GTTCTATAAATGGGAGCAGTGAC -3'

Sequencing Primer
(F):5'- TGCCTACAGAGAGGCTAGAATCC -3'
(R):5'- GTGACTGGCAAATACCCCTTG -3'

Posted On

2020-10-20