Incidental Mutation 'R8434:Vps33a'
ID653893
Institutional Source Beutler Lab
Gene Symbol Vps33a
Ensembl Gene ENSMUSG00000029434
Gene NameVPS33A CORVET/HOPS core subunit
Synonyms3830421M04Rik, bf
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8434 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location123528659-123573038 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123533881 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 475 (W475R)
Ref Sequence ENSEMBL: ENSMUSP00000031388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031388]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031388
AA Change: W475R

PolyPhen 2 Score 0.742 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031388
Gene: ENSMUSG00000029434
AA Change: W475R

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
Pfam:Sec1 34 592 7.2e-104 PFAM
Meta Mutation Damage Score 0.1324 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec-1 domain family, and it encodes a protein similar to the yeast class C Vps33 protein. The mammalian class C VPS proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene produce hypopigmentation, an extended bleeeding time and abnormal kidney function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,260 T737A probably damaging Het
2310034C09Rik A G 16: 88,759,372 Y158C probably damaging Het
Abhd18 T A 3: 40,930,896 S239T possibly damaging Het
Ankrd13b G A 11: 77,477,726 T56I probably benign Het
Arhgef10l T A 4: 140,564,271 Q454L possibly damaging Het
Atp1a2 T C 1: 172,284,612 E572G probably benign Het
Cdk5rap2 T C 4: 70,364,020 H164R probably benign Het
Clca4b A G 3: 144,926,156 M196T probably benign Het
Cnbd1 T G 4: 19,055,045 K127T probably benign Het
Cog3 A T 14: 75,742,396 V165E probably damaging Het
Crim1 G A 17: 78,347,257 R654H probably benign Het
Ctnnb1 G A 9: 120,957,562 V617I possibly damaging Het
Dach1 T A 14: 98,168,693 Q206L probably damaging Het
Dhx30 C T 9: 110,100,906 V41I probably benign Het
Dnase2a T C 8: 84,909,781 L176P probably damaging Het
Dpp10 T C 1: 123,433,010 D262G probably damaging Het
Dsel T A 1: 111,861,655 E383D probably damaging Het
Flt1 T A 5: 147,639,443 Y585F probably damaging Het
Fubp1 T A 3: 152,220,553 I304N probably damaging Het
Gab2 A G 7: 97,299,130 D309G probably damaging Het
Gon4l T C 3: 88,854,779 V291A probably damaging Het
Gpam C T 19: 55,081,631 V398M possibly damaging Het
Grin3b C T 10: 79,974,588 R643C probably damaging Het
Hdac3 T A 18: 37,941,422 H339L possibly damaging Het
Hsdl2 A T 4: 59,610,621 Q326L unknown Het
Insr T C 8: 3,165,514 probably benign Het
Ivl T A 3: 92,572,636 T41S probably benign Het
Lama4 C T 10: 39,026,707 P226S possibly damaging Het
Lpin1 A G 12: 16,563,620 probably null Het
Lrrc42 A T 4: 107,247,524 N81K probably damaging Het
Mast4 A T 13: 102,761,392 H838Q probably damaging Het
Mcmdc2 A G 1: 9,920,581 M314V possibly damaging Het
Me3 A G 7: 89,739,878 E130G probably damaging Het
Mpnd A G 17: 56,009,405 D28G possibly damaging Het
Mtch2 G T 2: 90,852,864 E102* probably null Het
Myh13 A T 11: 67,363,185 probably null Het
Olfr1117-ps1 G A 2: 87,284,634 V115I probably benign Het
Olfr291 C A 7: 84,857,289 H309N probably benign Het
Plch2 T A 4: 154,989,735 D891V probably damaging Het
Ppfibp2 T C 7: 107,728,750 probably null Het
Rag1 A G 2: 101,642,664 L711P probably damaging Het
Sacs T A 14: 61,213,187 Y4227* probably null Het
Sec23ip C T 7: 128,750,427 H176Y probably benign Het
Sema3a T C 5: 13,473,520 probably null Het
Serpina10 C T 12: 103,628,304 G219R probably damaging Het
Sp1 C T 15: 102,409,683 L546F probably benign Het
Syne1 T C 10: 5,123,057 N1256S probably benign Het
Tbc1d5 G T 17: 50,782,427 probably benign Het
Tcrg-V3 A G 13: 19,242,866 T8A probably benign Het
Tns1 T C 1: 73,925,606 S33G probably benign Het
Tpsab1 A G 17: 25,345,471 L3P possibly damaging Het
Vav2 A T 2: 27,269,038 probably benign Het
Vmn1r44 T C 6: 89,893,628 S119P possibly damaging Het
Vmn2r31 A G 7: 7,384,700 L624P probably damaging Het
Xpnpep3 G T 15: 81,427,594 R167L possibly damaging Het
Zfhx4 T A 3: 5,398,858 S1384T probably damaging Het
Zfp3 G A 11: 70,772,558 E448K probably benign Het
Zfp362 T A 4: 128,785,976 H299L probably damaging Het
Zfp664 C T 5: 124,885,763 L74F possibly damaging Het
Zfp808 A G 13: 62,172,112 Y385C probably damaging Het
Other mutations in Vps33a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Vps33a APN 5 123572943 missense probably benign 0.00
IGL01459:Vps33a APN 5 123535308 missense probably benign 0.08
IGL02473:Vps33a APN 5 123569571 missense probably damaging 1.00
IGL02899:Vps33a APN 5 123531176 missense probably damaging 1.00
R0498:Vps33a UTSW 5 123570961 missense probably benign 0.40
R1134:Vps33a UTSW 5 123570912 missense probably damaging 0.97
R1928:Vps33a UTSW 5 123558621 missense probably benign 0.02
R2012:Vps33a UTSW 5 123531181 splice site probably null
R2926:Vps33a UTSW 5 123569571 missense possibly damaging 0.83
R3688:Vps33a UTSW 5 123535211 splice site probably null
R3872:Vps33a UTSW 5 123531192 missense probably benign 0.16
R4437:Vps33a UTSW 5 123531884 missense probably benign
R5153:Vps33a UTSW 5 123558628 missense probably damaging 1.00
R5396:Vps33a UTSW 5 123558630 missense probably damaging 0.98
R5686:Vps33a UTSW 5 123547001 critical splice donor site probably null
R5714:Vps33a UTSW 5 123569500 missense probably benign
R5814:Vps33a UTSW 5 123565056 missense probably damaging 1.00
R6845:Vps33a UTSW 5 123535272 missense probably benign 0.02
R7183:Vps33a UTSW 5 123535215 missense probably null 0.83
R7359:Vps33a UTSW 5 123558633 missense probably benign 0.00
R7593:Vps33a UTSW 5 123536556 missense probably benign 0.00
R7855:Vps33a UTSW 5 123570979 missense possibly damaging 0.78
R7885:Vps33a UTSW 5 123535249 missense possibly damaging 0.70
R8025:Vps33a UTSW 5 123558675 missense possibly damaging 0.76
R8139:Vps33a UTSW 5 123533952 missense probably benign 0.04
R8275:Vps33a UTSW 5 123569459 missense probably damaging 0.99
R8845:Vps33a UTSW 5 123571475 critical splice donor site probably null
R8879:Vps33a UTSW 5 123533899 missense probably damaging 1.00
R8880:Vps33a UTSW 5 123569443 missense probably damaging 0.98
X0026:Vps33a UTSW 5 123547097 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CAACACACATGCACTGCTTTG -3'
(R):5'- ATCTGCAGGAGCCCTTTTC -3'

Sequencing Primer
(F):5'- AGTTCAAGCCCCAGAGCTG -3'
(R):5'- AGGAGCCCTTTTCCTGACCTAAC -3'
Posted On2020-10-20