Mutagenetix > Incidental Mutation

Incidental Mutation 'R8434:Vps33a'

653893

Institutional Source

Beutler Lab

Gene Symbol

Vps33a

Ensembl Gene

ENSMUSG00000029434

Gene Name

VPS33A CORVET/HOPS core subunit

Synonyms

3830421M04Rik, bf

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8434 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

123528659-123573038 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 123533881 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 475 (W475R)

Ref Sequence

ENSEMBL: ENSMUSP00000031388 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031388]

AlphaFold

Q9D2N9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031388
AA Change: W475R

PolyPhen 2 Score 0.742 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000031388
Gene: ENSMUSG00000029434
AA Change: W475R

Domain	Start	End	E-Value	Type
low complexity region	12	27	N/A	INTRINSIC
Pfam:Sec1	34	592	7.2e-104	PFAM

Meta Mutation Damage Score

0.1324

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec-1 domain family, and it encodes a protein similar to the yeast class C Vps33 protein. The mammalian class C VPS proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene produce hypopigmentation, an extended bleeeding time and abnormal kidney function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,067,260	T737A	probably damaging	Het
2310034C09Rik	A	G	16: 88,759,372	Y158C	probably damaging	Het
Abhd18	T	A	3: 40,930,896	S239T	possibly damaging	Het
Ankrd13b	G	A	11: 77,477,726	T56I	probably benign	Het
Arhgef10l	T	A	4: 140,564,271	Q454L	possibly damaging	Het
Atp1a2	T	C	1: 172,284,612	E572G	probably benign	Het
Cdk5rap2	T	C	4: 70,364,020	H164R	probably benign	Het
Clca4b	A	G	3: 144,926,156	M196T	probably benign	Het
Cnbd1	T	G	4: 19,055,045	K127T	probably benign	Het
Cog3	A	T	14: 75,742,396	V165E	probably damaging	Het
Crim1	G	A	17: 78,347,257	R654H	probably benign	Het
Ctnnb1	G	A	9: 120,957,562	V617I	possibly damaging	Het
Dach1	T	A	14: 98,168,693	Q206L	probably damaging	Het
Dhx30	C	T	9: 110,100,906	V41I	probably benign	Het
Dnase2a	T	C	8: 84,909,781	L176P	probably damaging	Het
Dpp10	T	C	1: 123,433,010	D262G	probably damaging	Het
Dsel	T	A	1: 111,861,655	E383D	probably damaging	Het
Flt1	T	A	5: 147,639,443	Y585F	probably damaging	Het
Fubp1	T	A	3: 152,220,553	I304N	probably damaging	Het
Gab2	A	G	7: 97,299,130	D309G	probably damaging	Het
Gon4l	T	C	3: 88,854,779	V291A	probably damaging	Het
Gpam	C	T	19: 55,081,631	V398M	possibly damaging	Het
Grin3b	C	T	10: 79,974,588	R643C	probably damaging	Het
Hdac3	T	A	18: 37,941,422	H339L	possibly damaging	Het
Hsdl2	A	T	4: 59,610,621	Q326L	unknown	Het
Insr	T	C	8: 3,165,514		probably benign	Het
Ivl	T	A	3: 92,572,636	T41S	probably benign	Het
Lama4	C	T	10: 39,026,707	P226S	possibly damaging	Het
Lpin1	A	G	12: 16,563,620		probably null	Het
Lrrc42	A	T	4: 107,247,524	N81K	probably damaging	Het
Mast4	A	T	13: 102,761,392	H838Q	probably damaging	Het
Mcmdc2	A	G	1: 9,920,581	M314V	possibly damaging	Het
Me3	A	G	7: 89,739,878	E130G	probably damaging	Het
Mpnd	A	G	17: 56,009,405	D28G	possibly damaging	Het
Mtch2	G	T	2: 90,852,864	E102*	probably null	Het
Myh13	A	T	11: 67,363,185		probably null	Het
Olfr1117-ps1	G	A	2: 87,284,634	V115I	probably benign	Het
Olfr291	C	A	7: 84,857,289	H309N	probably benign	Het
Plch2	T	A	4: 154,989,735	D891V	probably damaging	Het
Ppfibp2	T	C	7: 107,728,750		probably null	Het
Rag1	A	G	2: 101,642,664	L711P	probably damaging	Het
Sacs	T	A	14: 61,213,187	Y4227*	probably null	Het
Sec23ip	C	T	7: 128,750,427	H176Y	probably benign	Het
Sema3a	T	C	5: 13,473,520		probably null	Het
Serpina10	C	T	12: 103,628,304	G219R	probably damaging	Het
Sp1	C	T	15: 102,409,683	L546F	probably benign	Het
Syne1	T	C	10: 5,123,057	N1256S	probably benign	Het
Tbc1d5	G	T	17: 50,782,427		probably benign	Het
Tcrg-V3	A	G	13: 19,242,866	T8A	probably benign	Het
Tns1	T	C	1: 73,925,606	S33G	probably benign	Het
Tpsab1	A	G	17: 25,345,471	L3P	possibly damaging	Het
Vav2	A	T	2: 27,269,038		probably benign	Het
Vmn1r44	T	C	6: 89,893,628	S119P	possibly damaging	Het
Vmn2r31	A	G	7: 7,384,700	L624P	probably damaging	Het
Xpnpep3	G	T	15: 81,427,594	R167L	possibly damaging	Het
Zfhx4	T	A	3: 5,398,858	S1384T	probably damaging	Het
Zfp3	G	A	11: 70,772,558	E448K	probably benign	Het
Zfp362	T	A	4: 128,785,976	H299L	probably damaging	Het
Zfp664	C	T	5: 124,885,763	L74F	possibly damaging	Het
Zfp808	A	G	13: 62,172,112	Y385C	probably damaging	Het

Other mutations in Vps33a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01345:Vps33a	APN	5	123572943	missense	probably benign	0.00
IGL01459:Vps33a	APN	5	123535308	missense	probably benign	0.08
IGL02473:Vps33a	APN	5	123569571	missense	probably damaging	1.00
IGL02899:Vps33a	APN	5	123531176	missense	probably damaging	1.00
R0498:Vps33a	UTSW	5	123570961	missense	probably benign	0.40
R1134:Vps33a	UTSW	5	123570912	missense	probably damaging	0.97
R1928:Vps33a	UTSW	5	123558621	missense	probably benign	0.02
R2012:Vps33a	UTSW	5	123531181	splice site	probably null
R2926:Vps33a	UTSW	5	123569571	missense	possibly damaging	0.83
R3688:Vps33a	UTSW	5	123535211	splice site	probably null
R3872:Vps33a	UTSW	5	123531192	missense	probably benign	0.16
R4437:Vps33a	UTSW	5	123531884	missense	probably benign
R5153:Vps33a	UTSW	5	123558628	missense	probably damaging	1.00
R5396:Vps33a	UTSW	5	123558630	missense	probably damaging	0.98
R5686:Vps33a	UTSW	5	123547001	critical splice donor site	probably null
R5714:Vps33a	UTSW	5	123569500	missense	probably benign
R5814:Vps33a	UTSW	5	123565056	missense	probably damaging	1.00
R6845:Vps33a	UTSW	5	123535272	missense	probably benign	0.02
R7183:Vps33a	UTSW	5	123535215	missense	probably null	0.83
R7359:Vps33a	UTSW	5	123558633	missense	probably benign	0.00
R7593:Vps33a	UTSW	5	123536556	missense	probably benign	0.00
R7855:Vps33a	UTSW	5	123570979	missense	possibly damaging	0.78
R7885:Vps33a	UTSW	5	123535249	missense	possibly damaging	0.70
R8025:Vps33a	UTSW	5	123558675	missense	possibly damaging	0.76
R8139:Vps33a	UTSW	5	123533952	missense	probably benign	0.04
R8275:Vps33a	UTSW	5	123569459	missense	probably damaging	0.99
R8845:Vps33a	UTSW	5	123571475	critical splice donor site	probably null
R8879:Vps33a	UTSW	5	123533899	missense	probably damaging	1.00
R8880:Vps33a	UTSW	5	123569443	missense	probably damaging	0.98
R9172:Vps33a	UTSW	5	123536541	missense	probably benign	0.17
R9440:Vps33a	UTSW	5	123564984	missense	probably damaging	1.00
R9502:Vps33a	UTSW	5	123558642	missense	probably benign	0.00
R9725:Vps33a	UTSW	5	123531072	missense	possibly damaging	0.95
X0026:Vps33a	UTSW	5	123547097	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- CAACACACATGCACTGCTTTG -3'
(R):5'- ATCTGCAGGAGCCCTTTTC -3'

Sequencing Primer
(F):5'- AGTTCAAGCCCCAGAGCTG -3'
(R):5'- AGGAGCCCTTTTCCTGACCTAAC -3'

Posted On

2020-10-20