Incidental Mutation 'R8434:Zfp664'
ID653894
Institutional Source Beutler Lab
Gene Symbol Zfp664
Ensembl Gene ENSMUSG00000079215
Gene Namezinc finger protein 664
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8434 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location124862691-124902693 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 124885763 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 74 (L74F)
Ref Sequence ENSEMBL: ENSMUSP00000107048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111417]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111417
AA Change: L74F

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107048
Gene: ENSMUSG00000079215
AA Change: L74F

DomainStartEndE-ValueType
ZnF_C2H2 3 25 2.57e-3 SMART
ZnF_C2H2 31 53 7.55e-1 SMART
ZnF_C2H2 59 81 5.99e-4 SMART
ZnF_C2H2 87 109 3.21e-4 SMART
ZnF_C2H2 115 137 4.54e-4 SMART
ZnF_C2H2 143 165 4.79e-3 SMART
ZnF_C2H2 171 193 8.34e-3 SMART
ZnF_C2H2 199 221 6.23e-2 SMART
ZnF_C2H2 227 249 7.9e-4 SMART
Meta Mutation Damage Score 0.4137 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,260 T737A probably damaging Het
2310034C09Rik A G 16: 88,759,372 Y158C probably damaging Het
Abhd18 T A 3: 40,930,896 S239T possibly damaging Het
Ankrd13b G A 11: 77,477,726 T56I probably benign Het
Arhgef10l T A 4: 140,564,271 Q454L possibly damaging Het
Atp1a2 T C 1: 172,284,612 E572G probably benign Het
Cdk5rap2 T C 4: 70,364,020 H164R probably benign Het
Clca4b A G 3: 144,926,156 M196T probably benign Het
Cnbd1 T G 4: 19,055,045 K127T probably benign Het
Cog3 A T 14: 75,742,396 V165E probably damaging Het
Crim1 G A 17: 78,347,257 R654H probably benign Het
Ctnnb1 G A 9: 120,957,562 V617I possibly damaging Het
Dach1 T A 14: 98,168,693 Q206L probably damaging Het
Dhx30 C T 9: 110,100,906 V41I probably benign Het
Dnase2a T C 8: 84,909,781 L176P probably damaging Het
Dpp10 T C 1: 123,433,010 D262G probably damaging Het
Dsel T A 1: 111,861,655 E383D probably damaging Het
Flt1 T A 5: 147,639,443 Y585F probably damaging Het
Fubp1 T A 3: 152,220,553 I304N probably damaging Het
Gab2 A G 7: 97,299,130 D309G probably damaging Het
Gon4l T C 3: 88,854,779 V291A probably damaging Het
Gpam C T 19: 55,081,631 V398M possibly damaging Het
Grin3b C T 10: 79,974,588 R643C probably damaging Het
Hdac3 T A 18: 37,941,422 H339L possibly damaging Het
Hsdl2 A T 4: 59,610,621 Q326L unknown Het
Insr T C 8: 3,165,514 probably benign Het
Ivl T A 3: 92,572,636 T41S probably benign Het
Lama4 C T 10: 39,026,707 P226S possibly damaging Het
Lpin1 A G 12: 16,563,620 probably null Het
Lrrc42 A T 4: 107,247,524 N81K probably damaging Het
Mast4 A T 13: 102,761,392 H838Q probably damaging Het
Mcmdc2 A G 1: 9,920,581 M314V possibly damaging Het
Me3 A G 7: 89,739,878 E130G probably damaging Het
Mpnd A G 17: 56,009,405 D28G possibly damaging Het
Mtch2 G T 2: 90,852,864 E102* probably null Het
Myh13 A T 11: 67,363,185 probably null Het
Olfr1117-ps1 G A 2: 87,284,634 V115I probably benign Het
Olfr291 C A 7: 84,857,289 H309N probably benign Het
Plch2 T A 4: 154,989,735 D891V probably damaging Het
Ppfibp2 T C 7: 107,728,750 probably null Het
Rag1 A G 2: 101,642,664 L711P probably damaging Het
Sacs T A 14: 61,213,187 Y4227* probably null Het
Sec23ip C T 7: 128,750,427 H176Y probably benign Het
Sema3a T C 5: 13,473,520 probably null Het
Serpina10 C T 12: 103,628,304 G219R probably damaging Het
Sp1 C T 15: 102,409,683 L546F probably benign Het
Syne1 T C 10: 5,123,057 N1256S probably benign Het
Tbc1d5 G T 17: 50,782,427 probably benign Het
Tcrg-V3 A G 13: 19,242,866 T8A probably benign Het
Tns1 T C 1: 73,925,606 S33G probably benign Het
Tpsab1 A G 17: 25,345,471 L3P possibly damaging Het
Vav2 A T 2: 27,269,038 probably benign Het
Vmn1r44 T C 6: 89,893,628 S119P possibly damaging Het
Vmn2r31 A G 7: 7,384,700 L624P probably damaging Het
Vps33a A T 5: 123,533,881 W475R possibly damaging Het
Xpnpep3 G T 15: 81,427,594 R167L possibly damaging Het
Zfhx4 T A 3: 5,398,858 S1384T probably damaging Het
Zfp3 G A 11: 70,772,558 E448K probably benign Het
Zfp362 T A 4: 128,785,976 H299L probably damaging Het
Zfp808 A G 13: 62,172,112 Y385C probably damaging Het
Other mutations in Zfp664
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01556:Zfp664 APN 5 124886188 nonsense probably null
IGL02683:Zfp664 APN 5 124886322 missense probably benign 0.03
R0394:Zfp664 UTSW 5 124886065 nonsense probably null
R0629:Zfp664 UTSW 5 124885595 missense probably damaging 0.99
R1400:Zfp664 UTSW 5 124886153 missense unknown
R6052:Zfp664 UTSW 5 124886186 missense unknown
R6058:Zfp664 UTSW 5 124885978 nonsense probably null
R6529:Zfp664 UTSW 5 124886288 missense probably damaging 1.00
R7031:Zfp664 UTSW 5 124886006 missense probably benign 0.06
R7752:Zfp664 UTSW 5 124885775 nonsense probably null
R7901:Zfp664 UTSW 5 124885775 nonsense probably null
R8686:Zfp664 UTSW 5 124886069 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TACAAGTGCCCCATGTGCAG -3'
(R):5'- CTTTGATGCATGCAGAGGC -3'

Sequencing Primer
(F):5'- CCCATGTGCAGGGAATTTTTC -3'
(R):5'- ACTCTCTGGTGCATGCAGAG -3'
Posted On2020-10-20