Incidental Mutation 'R8434:Flt1'
ID653895
Institutional Source Beutler Lab
Gene Symbol Flt1
Ensembl Gene ENSMUSG00000029648
Gene NameFMS-like tyrosine kinase 1
SynonymsFlt-1, VEGFR1, vascular endothelial growth factor receptor-1, sFlt1, VEGFR-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8434 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location147561604-147726011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 147639443 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 585 (Y585F)
Ref Sequence ENSEMBL: ENSMUSP00000031653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031653] [ENSMUST00000110529]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000031653
AA Change: Y585F

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031653
Gene: ENSMUSG00000029648
AA Change: Y585F

DomainStartEndE-ValueType
IG 38 130 1.74e-3 SMART
IG 144 225 1.49e-2 SMART
IG 238 330 2.23e-10 SMART
IG 345 426 2.43e-2 SMART
IG 440 554 2.6e-2 SMART
IGc2 569 644 1.76e-8 SMART
IGc2 674 739 6.29e-19 SMART
low complexity region 769 786 N/A INTRINSIC
TyrKc 828 1154 9.54e-144 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110529
AA Change: Y585F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106158
Gene: ENSMUSG00000029648
AA Change: Y585F

DomainStartEndE-ValueType
IG 38 130 1.74e-3 SMART
IG 144 225 1.49e-2 SMART
IG 238 330 2.23e-10 SMART
IG 345 426 2.43e-2 SMART
IG 440 554 2.6e-2 SMART
IGc2 569 644 1.76e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vascular endothelial growth factor receptor (VEGFR) family. VEGFR family members are receptor tyrosine kinases (RTKs) which contain an extracellular ligand-binding region with seven immunoglobulin (Ig)-like domains, a transmembrane segment, and a tyrosine kinase (TK) domain within the cytoplasmic domain. This protein binds to VEGFR-A, VEGFR-B and placental growth factor and plays an important role in angiogenesis and vasculogenesis. Expression of this receptor is found in vascular endothelial cells, placental trophoblast cells and peripheral blood monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Isoforms include a full-length transmembrane receptor isoform and shortened, soluble isoforms. The soluble isoforms are associated with the onset of pre-eclampsia.[provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit an excess of hemangioblasts resulting in an overgrowth of endothelial cells, abnormalities of vascular channels and blood islands, and lethality at the mid-somite developmental stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,260 T737A probably damaging Het
2310034C09Rik A G 16: 88,759,372 Y158C probably damaging Het
Abhd18 T A 3: 40,930,896 S239T possibly damaging Het
Ankrd13b G A 11: 77,477,726 T56I probably benign Het
Arhgef10l T A 4: 140,564,271 Q454L possibly damaging Het
Atp1a2 T C 1: 172,284,612 E572G probably benign Het
Cdk5rap2 T C 4: 70,364,020 H164R probably benign Het
Clca4b A G 3: 144,926,156 M196T probably benign Het
Cnbd1 T G 4: 19,055,045 K127T probably benign Het
Cog3 A T 14: 75,742,396 V165E probably damaging Het
Crim1 G A 17: 78,347,257 R654H probably benign Het
Ctnnb1 G A 9: 120,957,562 V617I possibly damaging Het
Dach1 T A 14: 98,168,693 Q206L probably damaging Het
Dhx30 C T 9: 110,100,906 V41I probably benign Het
Dnase2a T C 8: 84,909,781 L176P probably damaging Het
Dpp10 T C 1: 123,433,010 D262G probably damaging Het
Dsel T A 1: 111,861,655 E383D probably damaging Het
Fubp1 T A 3: 152,220,553 I304N probably damaging Het
Gab2 A G 7: 97,299,130 D309G probably damaging Het
Gon4l T C 3: 88,854,779 V291A probably damaging Het
Gpam C T 19: 55,081,631 V398M possibly damaging Het
Grin3b C T 10: 79,974,588 R643C probably damaging Het
Hdac3 T A 18: 37,941,422 H339L possibly damaging Het
Hsdl2 A T 4: 59,610,621 Q326L unknown Het
Insr T C 8: 3,165,514 probably benign Het
Ivl T A 3: 92,572,636 T41S probably benign Het
Lama4 C T 10: 39,026,707 P226S possibly damaging Het
Lpin1 A G 12: 16,563,620 probably null Het
Lrrc42 A T 4: 107,247,524 N81K probably damaging Het
Mast4 A T 13: 102,761,392 H838Q probably damaging Het
Mcmdc2 A G 1: 9,920,581 M314V possibly damaging Het
Me3 A G 7: 89,739,878 E130G probably damaging Het
Mpnd A G 17: 56,009,405 D28G possibly damaging Het
Mtch2 G T 2: 90,852,864 E102* probably null Het
Myh13 A T 11: 67,363,185 probably null Het
Olfr1117-ps1 G A 2: 87,284,634 V115I probably benign Het
Olfr291 C A 7: 84,857,289 H309N probably benign Het
Plch2 T A 4: 154,989,735 D891V probably damaging Het
Ppfibp2 T C 7: 107,728,750 probably null Het
Rag1 A G 2: 101,642,664 L711P probably damaging Het
Sacs T A 14: 61,213,187 Y4227* probably null Het
Sec23ip C T 7: 128,750,427 H176Y probably benign Het
Sema3a T C 5: 13,473,520 probably null Het
Serpina10 C T 12: 103,628,304 G219R probably damaging Het
Sp1 C T 15: 102,409,683 L546F probably benign Het
Syne1 T C 10: 5,123,057 N1256S probably benign Het
Tbc1d5 G T 17: 50,782,427 probably benign Het
Tcrg-V3 A G 13: 19,242,866 T8A probably benign Het
Tns1 T C 1: 73,925,606 S33G probably benign Het
Tpsab1 A G 17: 25,345,471 L3P possibly damaging Het
Vav2 A T 2: 27,269,038 probably benign Het
Vmn1r44 T C 6: 89,893,628 S119P possibly damaging Het
Vmn2r31 A G 7: 7,384,700 L624P probably damaging Het
Vps33a A T 5: 123,533,881 W475R possibly damaging Het
Xpnpep3 G T 15: 81,427,594 R167L possibly damaging Het
Zfhx4 T A 3: 5,398,858 S1384T probably damaging Het
Zfp3 G A 11: 70,772,558 E448K probably benign Het
Zfp362 T A 4: 128,785,976 H299L probably damaging Het
Zfp664 C T 5: 124,885,763 L74F possibly damaging Het
Zfp808 A G 13: 62,172,112 Y385C probably damaging Het
Other mutations in Flt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Flt1 APN 5 147580300 critical splice donor site probably null
IGL00469:Flt1 APN 5 147603605 missense probably damaging 0.99
IGL00897:Flt1 APN 5 147589854 missense probably benign 0.25
IGL01111:Flt1 APN 5 147578336 missense probably damaging 1.00
IGL01154:Flt1 APN 5 147576156 missense possibly damaging 0.63
IGL01744:Flt1 APN 5 147571461 missense probably benign 0.01
IGL01973:Flt1 APN 5 147683889 missense probably benign 0.01
IGL02079:Flt1 APN 5 147568831 splice site probably benign
IGL02143:Flt1 APN 5 147578436 missense probably benign 0.00
IGL02156:Flt1 APN 5 147681741 missense probably damaging 0.99
IGL02345:Flt1 APN 5 147582626 missense probably benign 0.20
IGL02548:Flt1 APN 5 147639248 missense probably benign 0.00
IGL02631:Flt1 APN 5 147673574 nonsense probably null
IGL02686:Flt1 APN 5 147588602 missense probably damaging 1.00
IGL02938:Flt1 APN 5 147678299 missense possibly damaging 0.47
IGL03057:Flt1 APN 5 147681924 nonsense probably null
IGL03196:Flt1 APN 5 147615127 critical splice donor site probably null
IGL03205:Flt1 APN 5 147699821 missense probably benign 0.00
IGL03255:Flt1 APN 5 147588521 splice site probably benign
flywheels UTSW 5 147599646 missense probably damaging 1.00
BB008:Flt1 UTSW 5 147588572 missense probably damaging 1.00
BB018:Flt1 UTSW 5 147588572 missense probably damaging 1.00
IGL02837:Flt1 UTSW 5 147655170 missense probably benign 0.32
PIT4402001:Flt1 UTSW 5 147678239 missense probably damaging 1.00
R0013:Flt1 UTSW 5 147571014 splice site probably benign
R0380:Flt1 UTSW 5 147588572 missense probably damaging 1.00
R0448:Flt1 UTSW 5 147566394 splice site probably benign
R0789:Flt1 UTSW 5 147639483 missense probably damaging 1.00
R1005:Flt1 UTSW 5 147681885 missense probably damaging 0.99
R1241:Flt1 UTSW 5 147599646 missense probably damaging 1.00
R1302:Flt1 UTSW 5 147564240 missense possibly damaging 0.93
R1411:Flt1 UTSW 5 147580316 missense probably damaging 1.00
R1615:Flt1 UTSW 5 147639288 missense probably damaging 1.00
R1634:Flt1 UTSW 5 147676430 missense probably damaging 1.00
R1749:Flt1 UTSW 5 147655119 missense probably benign 0.00
R1768:Flt1 UTSW 5 147672709 missense probably damaging 1.00
R1972:Flt1 UTSW 5 147655093 splice site probably benign
R2074:Flt1 UTSW 5 147599606 missense possibly damaging 0.82
R2081:Flt1 UTSW 5 147639422 missense probably damaging 1.00
R2864:Flt1 UTSW 5 147594621 missense possibly damaging 0.68
R2865:Flt1 UTSW 5 147594621 missense possibly damaging 0.68
R3740:Flt1 UTSW 5 147599593 missense probably damaging 1.00
R3820:Flt1 UTSW 5 147700017 splice site probably benign
R4089:Flt1 UTSW 5 147564241 missense probably benign 0.03
R4299:Flt1 UTSW 5 147683907 missense probably benign 0.00
R4570:Flt1 UTSW 5 147594613 missense probably damaging 1.00
R4812:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4853:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4865:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4900:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4906:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4907:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4909:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5072:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5073:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5074:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5218:Flt1 UTSW 5 147681928 missense probably damaging 1.00
R5547:Flt1 UTSW 5 147655138 missense probably damaging 1.00
R5731:Flt1 UTSW 5 147678152 missense probably benign 0.16
R5732:Flt1 UTSW 5 147634483 nonsense probably null
R5804:Flt1 UTSW 5 147580437 splice site probably null
R6107:Flt1 UTSW 5 147603593 missense probably benign 0.15
R6440:Flt1 UTSW 5 147564305 missense possibly damaging 0.79
R6453:Flt1 UTSW 5 147683941 missense possibly damaging 0.80
R6539:Flt1 UTSW 5 147578376 missense probably benign 0.27
R7068:Flt1 UTSW 5 147673634 missense probably damaging 1.00
R7112:Flt1 UTSW 5 147603569 missense probably damaging 1.00
R7195:Flt1 UTSW 5 147603576 missense probably damaging 1.00
R7255:Flt1 UTSW 5 147580406 missense probably damaging 1.00
R7347:Flt1 UTSW 5 147580381 missense probably damaging 1.00
R7469:Flt1 UTSW 5 147603569 missense probably damaging 1.00
R7473:Flt1 UTSW 5 147594595 missense probably damaging 1.00
R7663:Flt1 UTSW 5 147655120 missense probably benign
R7688:Flt1 UTSW 5 147676325 missense probably benign
R7729:Flt1 UTSW 5 147700367 missense probably benign 0.00
R7931:Flt1 UTSW 5 147588572 missense probably damaging 1.00
R8051:Flt1 UTSW 5 147582691 missense probably benign 0.02
R8275:Flt1 UTSW 5 147678147 missense probably damaging 0.99
R8442:Flt1 UTSW 5 147576173 missense probably damaging 1.00
R8756:Flt1 UTSW 5 147639414 missense probably benign 0.07
R8855:Flt1 UTSW 5 147570872 missense probably benign 0.00
R8855:Flt1 UTSW 5 147681650 missense probably damaging 1.00
X0064:Flt1 UTSW 5 147673613 missense probably damaging 1.00
Z1088:Flt1 UTSW 5 147681649 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ACGAGAACTTCTGTCTTCCGAAG -3'
(R):5'- TCCTGCTGAGAGAATCCAAATG -3'

Sequencing Primer
(F):5'- CGAAGGATGTCTTCCCCTGTG -3'
(R):5'- TGCTGAGAGAATCCAAATGTGAATAC -3'
Posted On2020-10-20